From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1719 [new locus tag: SACOL_RS08780 ]
  • pan locus tag?: SAUPAN004287000
  • symbol: hemA
  • pan gene symbol?: hemA
  • synonym:
  • product: glutamyl-tRNA reductase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1719 [new locus tag: SACOL_RS08780 ]
  • symbol: hemA
  • product: glutamyl-tRNA reductase
  • replicon: chromosome
  • strand: -
  • coordinates: 1749527..1750873
  • length: 1347
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    ATGCATTTTATTGCAATTAGTATAAATCATCGCACAGCTGATGTTGCACTAAGAGAGCAA
    GTTGCTTTTAGAGATGATGCCTTACGAATTGCCCATGAAGATTTATATGAAACTAAATCT
    ATTTTAGAAAATGTCATATTATCAACATGTAATCGAACTGAAGTATATGCTGTTGTTGAT
    CAAATTCACACAGGTCGTTACTATATTCAACGATTTCTAGCTCGTGCATTTGGATTTGAA
    GTAGATGATATTAAAGCAATGTCAGAAGTAAAAGTGGGGGACGAAGCAGTAGAACATTTA
    TTGCGTGTCACTTCTGGTTTAGATTCAATCGTACTTGGAGAAACTCAAATTTTAGGTCAA
    ATAAGAGATGCATTTTTCTTAGCGCAAAGCACAGGTACGACAGGAACAATTTTTAATCAT
    CTATTTAAACAGGCAATTACTTTTGCAAAAAGAGCACATAATGAAACAGATATAGCTGAT
    AATGCTGTAAGTGTGTCTTATGCTGCGGTCGAGTTGGCGAAAAAAGTATTTGGCAAATTG
    AAAAGTAAGCAAGCTATCATTATTGGTGCAGGGGAAATGAGTGAATTATCACTATTAAAT
    CTTCTTGGTTCTGGAATTACTGATATTACAGTAGTAAATAGAACAATTGAAAATGCTATG
    AAATTAGCAGCAAAGCATCAAGTGAAATATGATGAACTATCATCATTACCAAATTTACTT
    GAAAGTGCAGATATTGTGATTAGTTCAACGAGTGCACAATCTTATATCATTACAAATGAA
    ATGATAGAAAGAATTGCAGAAAATAGAAAGCAAGATTCACTAGTATTGATTGATATTGCA
    GTTCCTCGAGATATTGAACCTGGTATTAGTGCCATCACAAACATCTTTAATTATGATGTT
    GATGACTTAAAAGGTTTAGTTGATGCAAACTTACGTGAGCGACAATTAGCGGCTGCAACA
    ATTTCGGAACAAATTCCTGCAGAAATACATGCACACAATGAGTGGATTAGTATGTTGGGT
    GTTGTTCCAGTGATTAGAGCTTTACGTGAAAAAGCTATGGCAATTCAAGCAGAAACGATG
    GACAGTATTGATCGTAAATTGCCAGGGTTAAGCGAAAGAGAACGTAAAATTATATCTAAA
    CATACAAAAAGTATCATCAATCAAATGTTGAAAGATCCTATTAAACAGGCCAAAGAATTA
    AGTAGTGATAAGAAAAGTAATGAAAAATTAGAGCTATTTCAAAATATATTTGATATCGAA
    GCTGAATGTCCTCATGAGCAAGCGAAGCAACAAAAAGAAAGCAAGGTCAAGGAAATTTCA
    GCGCGACGTATCTTTAGTTTTGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1347

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1719 [new locus tag: SACOL_RS08780 ]
  • symbol: HemA
  • description: glutamyl-tRNA reductase
  • length: 448
  • theoretical pI: 5.81316
  • theoretical MW: 50099
  • GRAVY: -0.148884

Function[edit source | edit]

  • reaction:
    EC 1.2.1.70?  ExPASy
    Glutamyl-tRNA reductaseL-glutamate 1-semialdehyde + NADP+ + tRNA(Glu) = L-glutamyl-tRNA(Glu) + NADPH
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminglutamyl-tRNA reductase (TIGR01035; EC 1.2.1.70; HMM-score: 449.5)
    MetabolismAmino acid biosynthesisAromatic amino acid familyshikimate dehydrogenase (TIGR00507; EC 1.1.1.25; HMM-score: 27.4)
    MetabolismAmino acid biosynthesisAromatic amino acid familyshikimate-5-dehydrogenase (TIGR01809; EC 1.1.1.25; HMM-score: 24.4)
    ectoine utilization protein EutC (TIGR02992; HMM-score: 22.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminsiroheme synthase, N-terminal domain (TIGR01470; HMM-score: 15.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis adenylyltransferase ThiF (TIGR02356; EC 2.7.7.73; HMM-score: 12.7)
  • TheSEED:  
    Cofactors, Vitamins, Prosthetic Groups, PigmentsTetrapyrrolesCPO analysis Glutamyl-tRNA reductase (EC 1.2.1.70) 
  • PFAM:
    NADP_Rossmann (CL0063) Shikimate_DH; Shikimate / quinate 5-dehydrogenase (PF01488; HMM-score: 153.1)
    no clan definedGlutR_N; Glutamyl-tRNAGlu reductase, N-terminal domain (PF05201; HMM-score: 144.6)
    GlutR_dimer; Glutamyl-tRNAGlu reductase, dimerisation domain (PF00745; HMM-score: 72.4)
    NADP_Rossmann (CL0063) OCD_Mu_crystall; Ornithine cyclodeaminase/mu-crystallin family (PF02423; HMM-score: 22.9)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 22.8)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 19.6)
    THF_DHG_CYH_C; Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (PF02882; HMM-score: 15.8)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 13.1)
    IlvN; Acetohydroxy acid isomeroreductase, NADPH-binding domain (PF07991; HMM-score: 13.1)
    ThiF; ThiF family (PF00899; HMM-score: 12.6)
    PELOTA (CL0101) RbsD_FucU; RbsD / FucU transport protein family (PF05025; HMM-score: 10.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.103
    • Ymax_pos: 58
    • Cmax: 0.141
    • Cmax_pos: 58
    • Smax: 0.123
    • Smax_pos: 1
    • Smean: 0.076
    • D: 0.093
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MHFIAISINHRTADVALREQVAFRDDALRIAHEDLYETKSILENVILSTCNRTEVYAVVDQIHTGRYYIQRFLARAFGFEVDDIKAMSEVKVGDEAVEHLLRVTSGLDSIVLGETQILGQIRDAFFLAQSTGTTGTIFNHLFKQAITFAKRAHNETDIADNAVSVSYAAVELAKKVFGKLKSKQAIIIGAGEMSELSLLNLLGSGITDITVVNRTIENAMKLAAKHQVKYDELSSLPNLLESADIVISSTSAQSYIITNEMIERIAENRKQDSLVLIDIAVPRDIEPGISAITNIFNYDVDDLKGLVDANLRERQLAAATISEQIPAEIHAHNEWISMLGVVPVIRALREKAMAIQAETMDSIDRKLPGLSERERKIISKHTKSIINQMLKDPIKQAKELSSDKKSNEKLELFQNIFDIEAECPHEQAKQQKESKVKEISARRIFSFE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]