From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1718 [new locus tag: SACOL_RS08775 ]
  • pan locus tag?: SAUPAN004286000
  • symbol: SACOL1718
  • pan gene symbol?: hemX
  • synonym:
  • product: hemX protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1718 [new locus tag: SACOL_RS08775 ]
  • symbol: SACOL1718
  • product: hemX protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1748690..1749505
  • length: 816
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGCAAGAAAACCTGTTTATTCGATTCAATGAAATTATATTATTAATATACTTAATCAGT
    ATCATTTGCTATTTTTATGATTTTGTACAAAAAAGTCATAAGATTAGAAGTTTAGGCATA
    TATTTATTGGGGATTGTTTGGGTTTTACAAACAATCTCTTTATCTATTTTTATTATACAA
    ACTAGACATATTCCATTAGGGTCTATTTCAGATGTATTCTATACTTTAAGTTGGCTGATT
    ATTTCAATCTCTTTAATTCTTAACCTTATCAAAGTTTTGAATTTCTCTGTGTTTTTCTTG
    AATTTAATAGGGTTAACACTTTTAGGGATGAATACATTTCAACCGACACATTATACTAAT
    AAGGTTCAGAAAATTGCTGTTGTAGACGAGTTACTGTTAGTCCATATCGGTCTAGCTGTG
    TTAAGTTATGTCTTCTTTGCCTTAGCTTTTGTCAATGCATTACTGTATATCATGCAATAC
    CGTAATTTGAAGGAAAAACGTTTTGATCAAAAATACTTTAGAATTGGTAGCGTTGCTACA
    CTTGAATCAATTGTGTTTTACTCAACGTTAAGTGGGTGGATAATTCTCATATTTAGTATT
    ATTTTAGGTACACAGTGGGGTGTAATTTCAGTTGGTGAACGTATATTCATTGACCCGAAG
    GTAATACTCTCTTCAATTATTACAGTATTATATGGAAGTTATATTTTACTTAGAATCAAC
    AAATGGTTGAATTCAAGATATTTAATATACTATAACATTATTTTATTTTGCTTAAATATG
    ATTAATTTATTTTTTGCAACACATTTTGTGAATTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    816

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1718 [new locus tag: SACOL_RS08775 ]
  • symbol: SACOL1718
  • description: hemX protein
  • length: 271
  • theoretical pI: 9.6883
  • theoretical MW: 31546.6
  • GRAVY: 0.934686

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein fateProtein modification and repaircytochrome c-type biogenesis protein CcsB (TIGR03144; HMM-score: 48.4)
    MetabolismEnergy metabolismElectron transportcytochrome c-type biogenesis protein CcsB (TIGR03144; HMM-score: 48.4)
  • TheSEED:  
    CBSS-196164.1.peg.461 HemX protein, negative effector of steady-state concentration of glutamyl-tRNA reductase 
  • PFAM:
    2heme_cytochrom (CL0328) Cytochrom_C_asm; Cytochrome C assembly protein (PF01578; HMM-score: 69.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 8
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.09
    • Ymax_pos: 70
    • Cmax: 0.132
    • Cmax_pos: 32
    • Smax: 0.102
    • Smax_pos: 64
    • Smean: 0.05
    • D: 0.075
  • predicted transmembrane helices (TMHMM): 8

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MQENLFIRFNEIILLIYLISIICYFYDFVQKSHKIRSLGIYLLGIVWVLQTISLSIFIIQTRHIPLGSISDVFYTLSWLIISISLILNLIKVLNFSVFFLNLIGLTLLGMNTFQPTHYTNKVQKIAVVDELLLVHIGLAVLSYVFFALAFVNALLYIMQYRNLKEKRFDQKYFRIGSVATLESIVFYSTLSGWIILIFSIILGTQWGVISVGERIFIDPKVILSSIITVLYGSYILLRINKWLNSRYLIYYNIILFCLNMINLFFATHFVN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]