From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2086 [new locus tag: SACOL_RS10915 ]
  • pan locus tag?: SAUPAN005376000
  • symbol: SACOL2086
  • pan gene symbol?: tenA
  • synonym:
  • product: TenA family transcription regulator

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2086 [new locus tag: SACOL_RS10915 ]
  • symbol: SACOL2086
  • product: TenA family transcription regulator
  • replicon: chromosome
  • strand: -
  • coordinates: 2150823..2151512
  • length: 690
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGGAATTTTCACAAAAATTGTACCAAGCTGCAAAGCCAATCATTAATGATATTTATGAG
    GATGACTTTATTCAGAAGATGTTATCCGGAGATATAGGAGCTGACGCATTACGCCATTAC
    TTAAAAGCTGATGCTGCGTATTTAAAAGAATTTACAAACTTATATGCTTTGTTAATTCCA
    AAAATGAATAGCATGAATGACGTAAAATTTTTAGTAGAGCAAATAGAATTTATGGTTGAA
    GGTGAAGTACTTGCGCATGATATTTTAGCGCAAATTGTTGGTGAATCATACGAAGAAATC
    ATTAAAACAAAAGTTTGGCCTCCAAGTGGCGACCATTACATAAAACATATGTATTTCCAA
    GCGCATAGTCGTGAAAATGCTATTTATACAATTGCTGCAATGGCACCTTGTCCATATATT
    TATGCAGAATTAGCTAAGCGCTCTCAAAGTGATCATAAGCTTAATAGAGAAAAAGATACG
    GCAAAATGGTTTGATTTTTATAGTACTGAAATGGATGACATAATTAACGTATTTGAGGCA
    TTAATGAATAAATTAGCCGAATCAATGTCTGACAAGGAATTGGAACAAGTAAAGCAAGTA
    TTTTTAGAAAGTTGCATACATGAGCGTCGATTTTTCAATATGGCTATGACACTAGAACAA
    TGGGAATTTGGAGGAAAAGTAAATGATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    690

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2086 [new locus tag: SACOL_RS10915 ]
  • symbol: SACOL2086
  • description: TenA family transcription regulator
  • length: 229
  • theoretical pI: 4.66731
  • theoretical MW: 26728.4
  • GRAVY: -0.321834

Function[edit source | edit]

  • reaction:
    EC 3.5.99.2?  ExPASy
    Aminopyrimidine aminohydrolase4-amino-5-aminomethyl-2-methylpyrimidine + H2O = 4-amino-5-hydroxymethyl-2-methylpyrimidine + ammoniaThiamine + H2O = 4-amino-5-hydroxymethyl-2-methylpyrimidine + 5-(2-hydroxyethyl)-4-methylthiazole
  • TIGRFAM:
    thiaminase II (TIGR04306; EC 3.5.99.2; HMM-score: 311.3)
  • TheSEED:  
    Cofactors, Vitamins, Prosthetic Groups, PigmentsCofactors, Vitamins, Prosthetic Groups, Pigments - no subcategoryThiamin biosynthesis Thiaminase II (EC 3.5.99.2) involved in salvage of thiamin pyrimidine moiety 
  • PFAM:
    HO (CL0230) TENA_THI-4; TENA/THI-4/PQQC family (PF03070; HMM-score: 138.6)
    no clan definedImm30; Immunity protein 30 (PF15565; HMM-score: 18.1)
    EF_hand (CL0220) SPARC_Ca_bdg; Secreted protein acidic and rich in cysteine Ca binding region (PF10591; HMM-score: 12.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.096
    • Ymax_pos: 46
    • Cmax: 0.153
    • Cmax_pos: 46
    • Smax: 0.111
    • Smax_pos: 69
    • Smean: 0.057
    • D: 0.081
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MEFSQKLYQAAKPIINDIYEDDFIQKMLSGDIGADALRHYLKADAAYLKEFTNLYALLIPKMNSMNDVKFLVEQIEFMVEGEVLAHDILAQIVGESYEEIIKTKVWPPSGDHYIKHMYFQAHSRENAIYTIAAMAPCPYIYAELAKRSQSDHKLNREKDTAKWFDFYSTEMDDIINVFEALMNKLAESMSDKELEQVKQVFLESCIHERRFFNMAMTLEQWEFGGKVND

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]