From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2399 [new locus tag: SACOL_RS12585 ]
  • pan locus tag?: SAUPAN005933000
  • symbol: nirR
  • pan gene symbol?: nirR
  • synonym:
  • product: transcriptional regulator NirR

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2399 [new locus tag: SACOL_RS12585 ]
  • symbol: nirR
  • product: transcriptional regulator NirR
  • replicon: chromosome
  • strand: -
  • coordinates: 2460981..2461712
  • length: 732
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    GTGAATGGGAATATCATTGTTGCACATGGCATGAGGCACGGACGACAGAATCAAGCGTTA
    GAAGCATTTATTTCTGAATTAGTAAAAGATGATATACATCACTATGATATTGCGTTTTTA
    GAAAGTGAGCATCAGGATTTAGAGACGGTAATGACGACGTTGATTCAAAGTGGGGTTGAC
    CATTTTAAAATTGTACCATTGCTAATCTTTAGTGCAATGCATTATCTCAAGGATATACCG
    AATATCGTTCATGAAATGAAACGACGGTATCCAGACATAAAGGTAGAAGTAAGCGAGCCA
    CTTGGCACACATCCTTTAATGAGACGATTAATTGAACAACGTATTTGTGACGCATTAGCA
    GGTGACGAACAACAAGTTGGAGTTATGGTTGTTGCACACGGCAATATTAATGGAAAGTTT
    ACTAAGGCACACGAAGAGTTACAAATATGCGCTCAAAATTTGCAAATTAGCAAGCCGACA
    TATGCGAGAACGCTATATGGAGAGATTAGTTTTACACATGATTTAGAAAGCATCTCGAAA
    CGGTATCAAAAATTGATTGTCGTACCATTATTTTTATATGACGGAAGACTTGTTAACAAA
    GTGAAGCAGCAAATGAATGACATGGTTATTAATACAGATATACACTTCACACCTTCAATT
    AACTTCGACCCAATTTTAAAGCAAATCATTAACGATAGATTAGAAAGCTTAATGATTCCA
    ATGAAAATATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    732

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2399 [new locus tag: SACOL_RS12585 ]
  • symbol: NirR
  • description: transcriptional regulator NirR
  • length: 243
  • theoretical pI: 6.70595
  • theoretical MW: 27948.3
  • GRAVY: -0.147325

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:  
    Sirohydrochlorin ferrochelatase (EC 4.99.1.4) 
  • PFAM:
    Chelatase (CL0043) CbiX; CbiX (PF01903; HMM-score: 115.9)
    CbiK; Cobalt chelatase (CbiK) (PF06180; HMM-score: 21.9)
    no clan definedDUF3928; Protein of unknown function (DUF3928) (PF13065; HMM-score: 14.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.105
    • Ymax_pos: 22
    • Cmax: 0.125
    • Cmax_pos: 22
    • Smax: 0.151
    • Smax_pos: 17
    • Smean: 0.083
    • D: 0.096
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNGNIIVAHGMRHGRQNQALEAFISELVKDDIHHYDIAFLESEHQDLETVMTTLIQSGVDHFKIVPLLIFSAMHYLKDIPNIVHEMKRRYPDIKVEVSEPLGTHPLMRRLIEQRICDALAGDEQQVGVMVVAHGNINGKFTKAHEELQICAQNLQISKPTYARTLYGEISFTHDLESISKRYQKLIVVPLFLYDGRLVNKVKQQMNDMVINTDIHFTPSINFDPILKQIINDRLESLMIPMKI

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulators: SACOL2035 (Rex*), SACOL2389 (NreC*)
    Rex* (TF) important in Energy metabolism  RegPrecise
    NreC* (TF) important in Nitrate and nitrite respiration  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]