From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2482
  • pan locus tag?: SAUPAN006035000
  • symbol: fabG2
  • pan gene symbol?:
  • synonym:
  • product:

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: pseudogene
  • locus tag: SACOL2482
  • symbol: fabG2
  • product:
  • replicon: chromosome
  • strand: -
  • coordinates: 2538248..2539066
  • length: 819
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGAAACGTTTGGAAAATAAAGTAGCAGTCGTAACAGGAGCAAGTACAGGTATCGGTCAA
    GCTTCTGCAATCGCTTTAGCTCAATAAGGTGCGTATGTATTGGCGGTAGACATAGCTGAA
    GCGGTATCGGAGACTGTCGATAAAATTAAAAGTAATGGTGACAATGCGAAGGCGTATAAT
    GTGGATAATGCAAGCGAACAACAAGTGGTAGACTTTGTGTCTGACATAAAGGAACAGTTT
    GGAAGAATCGATGTGTTGTTTAATAATGCCGGTGTGGATAATGCGGCTGATAGAATTCAT
    GAGTATCCAATAGATGTGTATGACAAGATTATGAATGTAGATATGCGTGGGACATTTTTA
    ATGACGAAAATGATGTTACCTTTAATGATGAATCAAGGTGGCTCTATTGTTAATACGTCT
    TCATTTTCCGGACAAGCAGCAGACTTGTATCGCTCTGGATATAATGCTGCGAAAGGTGCA
    GTGATTAATTTTACAAAATCAATCGCAATTGAGTATGGCCGTGATAGCATTCGAGCCAAT
    GCGATTGCACCAGGTACAATTGAAACCCCGTTAGTAGATAAACTGACAGGTACGAGTGAG
    GATGATGCAGGTAAAACATTTAGAGAAAATCAAAAATGGATGACTCCGCTGGGACGTTTA
    GGTAAACCAGAAGAAGTTGCTAAATTAGTAGTCTTCTTAGCATCTGACGACAGTTCATTC
    ATAACTGGAGAGACGATTCGAATTGATGGTGGTGTGATGGCTTACACATGGCCTGGCGAG
    ATGTTAAGTGATGATTCGTGGAAGCGGACATTGGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    819

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2482
  • symbol: FabG2
  • description:
  • length: 0
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:
  • PFAM:

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Accession numbers[edit source | edit]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit source | edit]

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor: RpoF (SigB*) [1] [2] other strains
    RpoF  (SigB*) (sigma factor) controls a large regulon involved in stress/starvation response and adaptation
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
    The sigmaB regulon in Staphylococcus aureus and its regulation.
    Int. J. Med. Microbiol.: 2006, 296(4-5);237-58
    [PubMed:16644280] [WorldCat.org] [DOI] (P p)
  2. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J. Bacteriol.: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)

Relevant publications[edit source | edit]