From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2529 [new locus tag: SACOL_RS13250 ]
  • pan locus tag?: SAUPAN006162000
  • symbol: SACOL2529
  • pan gene symbol?:
  • synonym:
  • product: phospholipase/carboxylesterase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2529 [new locus tag: SACOL_RS13250 ]
  • symbol: SACOL2529
  • product: phospholipase/carboxylesterase
  • replicon: chromosome
  • strand: -
  • coordinates: 2591470..2592063
  • length: 594
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGGAACATATTTTTAGAGAAGGACAAAATGGTGCGCCAACACTAATATTATTGCATGGT
    ACAGGTGGTGATGAGTTCGATTTATTACCGTTAGGCGAAGCATTGAATGAAAATTATCAC
    TTGTTAAGTATTAGAGGACAAGTTTCAGAAAATGGGATGAACCGTTATTTCAAACGTCTT
    GGTGAAGGTGTTTATGATGAAGAAGATTTGGCATTTCGTGGACAAGAATTGTTGACGTTC
    ATTAAAGAAGCTGCTGAACGTTATGATTTTGATATTGAAAAAGCAGTACTTGTTGGATTT
    TCAAATGGATCAAATATAGCGATTAACTTAATGTTGCGTTCAGAAGCACCATTTAAAAAA
    GCATTGTTATATGCACCGTTATACCCAGTTGAAGTAACGTCAACAAAGGATTTATCAGAT
    GTCAGTGTGTTGCTTTCTATGGGGAAACATGATCCAATTGTGCCATTAGCTGCAAGTGAA
    CAAGTCATTAACTTGTTTAATACACGTGGGGCACAAGTCGAAGAAGTTTGGGTGAAGGGC
    CATGAAATTACAGAAACTGGATTAACGGCTGGTCAACAAATACTTGGGAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    594

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2529 [new locus tag: SACOL_RS13250 ]
  • symbol: SACOL2529
  • description: phospholipase/carboxylesterase
  • length: 197
  • theoretical pI: 4.54427
  • theoretical MW: 21792.6
  • GRAVY: -0.147208

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (TIGR03695; EC 4.2.99.20; HMM-score: 21.8)
    pyrimidine utilization protein D (TIGR03611; HMM-score: 18.6)
    MetabolismEnergy metabolismPhotosynthesisputative magnesium chelatase accessory protein (TIGR03056; HMM-score: 13.5)
  • TheSEED:  
    Carboxylesterase (EC 3.1.1.1) 
  • PFAM:
    AB_hydrolase (CL0028) Abhydrolase_2; Phospholipase/Carboxylesterase (PF02230; HMM-score: 41.1)
    Hydrolase_4; Serine aminopeptidase, S33 (PF12146; HMM-score: 28)
    DLH; Dienelactone hydrolase family (PF01738; HMM-score: 21.5)
    Peptidase_S9; Prolyl oligopeptidase family (PF00326; HMM-score: 19.9)
    Abhydrolase_6; Alpha/beta hydrolase family (PF12697; HMM-score: 18.9)
    Esterase; Putative esterase (PF00756; HMM-score: 18.2)
    Abhydrolase_3; alpha/beta hydrolase fold (PF07859; HMM-score: 18.1)
    DUF915; Alpha/beta hydrolase of unknown function (DUF915) (PF06028; HMM-score: 16.8)
    FSH1; Serine hydrolase (FSH1) (PF03959; HMM-score: 13.6)
    Abhydrolase_1; alpha/beta hydrolase fold (PF00561; HMM-score: 13)
    Abhydrolase_4; TAP-like protein (PF08386; HMM-score: 11.7)
    DUF676; Putative serine esterase (DUF676) (PF05057; HMM-score: 11.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.103
    • Ymax_pos: 27
    • Cmax: 0.114
    • Cmax_pos: 27
    • Smax: 0.131
    • Smax_pos: 21
    • Smean: 0.079
    • D: 0.093
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MEHIFREGQNGAPTLILLHGTGGDEFDLLPLGEALNENYHLLSIRGQVSENGMNRYFKRLGEGVYDEEDLAFRGQELLTFIKEAAERYDFDIEKAVLVGFSNGSNIAINLMLRSEAPFKKALLYAPLYPVEVTSTKDLSDVSVLLSMGKHDPIVPLAASEQVINLFNTRGAQVEEVWVKGHEITETGLTAGQQILGK

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1] [2] [3]
    quantitative data / protein copy number per cell: 42 [4]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]