From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS01215 [old locus tag: SACOL0240 ]
  • pan locus tag?: SAUPAN001133000
  • symbol: SACOL_RS01215
  • pan gene symbol?: tarI
  • synonym:
  • product: 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS01215 [old locus tag: SACOL0240 ]
  • symbol: SACOL_RS01215
  • product: 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
  • replicon: chromosome
  • strand: +
  • coordinates: 279162..279878
  • length: 717
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (279162..279878) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGAAATACGCTGGTATTCTAGCTGGAGGTATAGGCTCAAGAATGGGTAACGTACCTTTA
    CCTAAACAATTTTTAGATTTAGACAACAAACCGATTTTAATCCATACATTAGAAAAATTT
    ATTTTAATTAATGATTTTGAAAAAATTATTATCGCGACGCCACAACAATGGATGACGCAT
    ACGAAAGATACACTTAGAAAATTCAAAATTTCTGATGAAAGAATTGAAGTCATTCAAGGT
    GGTAGCGATCGTAACGATACAATTATGAATATCGTTAAACATATTGAATCAACAAATGGT
    ATTAACGATGACGATGTCATTGTGACACATGATGCAGTTAGACCATTTTTAACGCATCGT
    ATTATTAAAGAAAATATTCAAGCTGCTTTAGAGTACGGTGCAGTAGATACAGTGATTGAT
    GCTATAGATACGATTGTTACATCTAAAGATAATCAAACGATTGATGCAATTCCAGTGCGT
    AATGAAATGTACCAAGGTCAAACACCTCAATCGTTTAATATTAATTTATTAAAAGAAAGC
    TATGCACAGTTGAGTGATGAGCAAAAGAGTATTTTATCTGATGCTTGTAAGATTATTGTA
    GAAACAAACAAACCGGTTCGACTTGTAAAAGGTGAGTTATATAACATTAAAGTAACAACA
    CCTTACGATTTAAAAGTAGCGAATGCTATTATTCGAGGTGGTATTGCCGATGATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    717

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS01215 [old locus tag: SACOL0240 ]
  • symbol: SACOL_RS01215
  • description: 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
  • length: 238
  • theoretical pI: 5.36178
  • theoretical MW: 26656.4
  • GRAVY: -0.215546

Function[edit source | edit]

  • reaction:
    EC 2.7.7.60?  ExPASy
    2-C-methyl-D-erythritol 4-phosphate cytidylyltransferaseCTP + 2-C-methyl-D-erythritol 4-phosphate = diphosphate + 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOther2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (TIGR00453; EC 2.7.7.60; HMM-score: 156.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMolybdopterinmolybdenum cofactor guanylyltransferase (TIGR02665; EC 2.7.7.77; HMM-score: 19.6)
    molybdenum cofactor cytidylyltransferase (TIGR03310; EC 2.7.7.76; HMM-score: 19.2)
    glucose-1-phosphate thymidylyltransferase (TIGR01208; EC 2.7.7.24; HMM-score: 16.8)
    Hypothetical proteinsConservedTIGR00454 family protein (TIGR00454; HMM-score: 14.6)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesmannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase (TIGR01479; EC 2.7.7.13,5.3.1.8; HMM-score: 14.5)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesglucose-1-phosphate cytidylyltransferase (TIGR02623; EC 2.7.7.33; HMM-score: 14)
    Cell structureCell envelopeOtherrare lipoprotein A (TIGR00413; HMM-score: 13.4)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesglucose-1-phosphate thymidylyltransferase (TIGR01207; EC 2.7.7.24; HMM-score: 13.2)
  • TheSEED:
  • PFAM:
    GT-A (CL0110) IspD; 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (PF01128; HMM-score: 145.9)
    NTP_transf_3; MobA-like NTP transferase domain (PF12804; HMM-score: 31.8)
    CTP_transf_3; Cytidylyltransferase (PF02348; HMM-score: 25)
    NTP_transferase; Nucleotidyl transferase (PF00483; HMM-score: 18.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL_RS05630pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SACOL_RS1169530S ribosomal protein S5  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.126
    • Ymax_pos: 25
    • Cmax: 0.127
    • Cmax_pos: 25
    • Smax: 0.179
    • Smax_pos: 5
    • Smean: 0.13
    • D: 0.128
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446795230 NCBI
  • RefSeq: WP_000872486 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKYAGILAGGIGSRMGNVPLPKQFLDLDNKPILIHTLEKFILINDFEKIIIATPQQWMTHTKDTLRKFKISDERIEVIQGGSDRNDTIMNIVKHIESTNGINDDDVIVTHDAVRPFLTHRIIKENIQAALEYGAVDTVIDAIDTIVTSKDNQTIDAIPVRNEMYQGQTPQSFNINLLKESYAQLSDEQKSILSDACKIIVETNKPVRLVKGELYNIKVTTPYDLKVANAIIRGGIADD

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS01215 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]