From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS02235 [old locus tag: SACOL0443 ]
  • pan locus tag?: SAUPAN001970000
  • symbol: SACOL_RS02235
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS02235 [old locus tag: SACOL0443 ]
  • symbol: SACOL_RS02235
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 446938..447306
  • length: 369
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (446938..447306) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    TTGAAAACGATTTTAAAAACAATAACATATCTTGTACTTACTATCATTGGCGCTTATGCT
    GCTTTATTCATTTTAAAAACAATAGACTCCCATGGTATAACAGATCAATTTAACCCATTA
    GTAAAGAAGGATGATTCTTATGTTAAAACGACAGAGGTGTCTACTAGAATGGATGATCAA
    CTCCGAAGTTATAGTCAAAGTGTTTTTAATAAAGAAGGGAAAGAGACGCAATTAATGTAT
    ACTGCTACATTTGATGTTAAACCGCATAGATACTTGAAAATTACACATAAAGGTCATCAT
    GTAGAAACTTTTGAAGAAGTTGAAAAGGAAGAAGTACCAAAGAAAGCATTAGACAAACTG
    AGTCGATAA
    60
    120
    180
    240
    300
    360
    369

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS02235 [old locus tag: SACOL0443 ]
  • symbol: SACOL_RS02235
  • description: hypothetical protein
  • length: 122
  • theoretical pI: 9.26271
  • theoretical MW: 14125.2
  • GRAVY: -0.477869

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Hypothetical proteinsConservedconserved hypothetical protein (TIGR01655; HMM-score: 59.8)
  • TheSEED:
  • PFAM:
    no clan definedDUF1093; Protein of unknown function (DUF1093) (PF06486; HMM-score: 53.4)
    Trigger_N; Bacterial trigger factor protein (TF) (PF05697; HMM-score: 16.3)
    Trigger_C (CL0262) SurA_N_3; SurA N-terminal domain (PF13624; HMM-score: 12.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 3.33
    • Cellwall Score: 3.33
    • Extracellular Score: 3.33
    • Internal Helix: 1
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.233
    • Ymax_pos: 21
    • Cmax: 0.218
    • Cmax_pos: 21
    • Smax: 0.479
    • Smax_pos: 1
    • Smean: 0.305
    • D: 0.261
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

  • GI: 446771921 NCBI
  • RefSeq: WP_000849177 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKTILKTITYLVLTIIGAYAALFILKTIDSHGITDQFNPLVKKDDSYVKTTEVSTRMDDQLRSYSQSVFNKEGKETQLMYTATFDVKPHRYLKITHKGHHVETFEEVEKEEVPKKALDKLSR

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS02235 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]