From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS03260 [old locus tag: SACOL0631 ]
  • pan locus tag?: SAUPAN002363000
  • symbol: SACOL_RS03260
  • pan gene symbol?:
  • synonym:
  • product: membrane protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS03260 [old locus tag: SACOL0631 ]
  • symbol: SACOL_RS03260
  • product: membrane protein
  • replicon: chromosome
  • strand: -
  • coordinates: 663049..663501
  • length: 453
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (663049..663501) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGTTTTGGATCTTAAACTTTATCTTTAGCTTTTTAGCTTCAATGTTCTTCTGCGTCATT
    TTTGATGCACCTAGAAAATTATATCTATCATGTGGTTTCGTTGGTACGTGTGGATGGATG
    GTTTACACCTTATTCTTCAACGGCTTTAATGTGCACACTATATACTCTAGTTTCTTTGGT
    AGTTTAGCATTAGGCTTGTTAAGTCATTATATGGCTCGTAAACAAAAAGAACCTGCCATC
    ATTTTTATGGTAACGGGTATCATTCCATTAGTACCTGGTGGCTTAGCATACGATGCTACA
    AAAAATTTAGTCTTATTAAATTTCAGTACAGCAATCAATACCATGCTAGAGGTTACACTT
    ATTGCAGGCGCCATCGCATTAGGTTTATTATTCGCCGACCAAATTTCCAAATTAATTGTT
    TCTGGGTTCGTGAAATCTTTTAAACGATTATAA
    60
    120
    180
    240
    300
    360
    420
    453

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS03260 [old locus tag: SACOL0631 ]
  • symbol: SACOL_RS03260
  • description: membrane protein
  • length: 150
  • theoretical pI: 9.5134
  • theoretical MW: 16667.9
  • GRAVY: 0.964

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:
  • PFAM:
    UMP_1 (CL0470) ThrE_2; Threonine/Serine exporter, ThrE (PF12821; HMM-score: 134)
    ThrE; Putative threonine/serine exporter (PF06738; HMM-score: 34.1)
    no clan definedFlp_Fap; Flp/Fap pilin component (PF04964; HMM-score: 16.4)
    GPCR_A (CL0192) 7TMR-DISM_7TM; 7TM diverse intracellular signalling (PF07695; HMM-score: 12.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 5
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.172
    • Ymax_pos: 23
    • Cmax: 0.168
    • Cmax_pos: 23
    • Smax: 0.387
    • Smax_pos: 7
    • Smean: 0.229
    • D: 0.194
  • predicted transmembrane helices (TMHMM): 4

Accession numbers[edit source | edit]

  • GI: 446420717 NCBI
  • RefSeq: WP_000498572 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MFWILNFIFSFLASMFFCVIFDAPRKLYLSCGFVGTCGWMVYTLFFNGFNVHTIYSSFFGSLALGLLSHYMARKQKEPAIIFMVTGIIPLVPGGLAYDATKNLVLLNFSTAINTMLEVTLIAGAIALGLLFADQISKLIVSGFVKSFKRL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS03260 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]