From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS05595 [old locus tag: SACOL1096 ]
  • pan locus tag?: SAUPAN003308000
  • symbol: SACOL_RS05595
  • pan gene symbol?: ktrA
  • synonym:
  • product: potassium transporter Trk

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS05595 [old locus tag: SACOL1096 ]
  • symbol: SACOL_RS05595
  • product: potassium transporter Trk
  • replicon: chromosome
  • strand: +
  • coordinates: 1106950..1107612
  • length: 663
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1106950..1107612) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGGGTAAAGAATATGTAGTCATCGGTCTAGGTCGTTTTGGAGGTAGTATCGTTCGTGAG
    TTGAATGCATTAGACATGGATGTAATGGCCATCGACCATGATGAAAATAGAGTGAATGAA
    TATAGTGATATCGCTACTCATGCGGTTGTTGCAGACACTACAGATGAAGCAGTTATGAAA
    AGTTTAGGTATCCGTAACTTTGATCATGTCATTGTGGCAATTGGTGAAAATATTCAATCA
    AGTACGTTGACGACTTTAATTTTAAAAGAGTTAGGTGTAAAAAAAGTAACTGCTAAAGCA
    CAAAATGATTATCATGCAAAGATTTTAAATAAAATTGGAGCAGATACGGTTGTGCACCCT
    GAGCGTGATATGGGTAGACGTATTGCGCATAATGTTGCGAGTGCAAGTGTACTTGATTAT
    CTTGAGTTGGCAGACGAGCATTCTATTGTAGAATTGAAAGCAACTGAAAAGATGGCGGGG
    CAGTCTATCATTGATTTAGATATAAGAGCACAATATGGAATTAACATTATTGCAATTAAA
    CGAGGCAAAGAGTTCATCATTTCACCAAATCCAAATATTAATTTAGAAATAGGTGATATT
    TTAATCATGATTGGACATGATAATGATTTAAATCGCTTTGAAAAAAATATTGCGACGAGA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    663

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS05595 [old locus tag: SACOL1096 ]
  • symbol: SACOL_RS05595
  • description: potassium transporter Trk
  • length: 220
  • theoretical pI: 5.32766
  • theoretical MW: 24282.6
  • GRAVY: -0.08

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    aspartate-alanine antiporter (TIGR03802; HMM-score: 19.5)
    MetabolismEnergy metabolismPentose phosphate pathway6-phosphogluconate dehydrogenase (decarboxylating) (TIGR00872; EC 1.1.1.44; HMM-score: 16.2)
    6-hydroxycyclohex-1-ene-1-carbonyl-CoA dehydrogenase (TIGR03201; EC 1.1.1.-; HMM-score: 16)
    MetabolismEnergy metabolismAmino acids and aminesL-threonine 3-dehydrogenase (TIGR00692; EC 1.1.1.103; HMM-score: 15.1)
    Genetic information processingProtein fateProtein folding and stabilizationxanthine dehydrogenase accessory protein XdhC (TIGR02964; HMM-score: 14.6)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesOtherxanthine dehydrogenase accessory protein XdhC (TIGR02964; HMM-score: 14.6)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisphosphoribosylglycinamide formyltransferase 2 (TIGR01142; EC 2.1.2.-; HMM-score: 13.6)
    Unknown functionEnzymes of unknown specificityputative quinone oxidoreductase, YhdH/YhfP family (TIGR02823; HMM-score: 13.2)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) TrkA_N; TrkA-N domain (PF02254; HMM-score: 104.5)
    TrkA_C (CL0582) TrkA_C; TrkA-C domain (PF02080; HMM-score: 54.6)
    NADP_Rossmann (CL0063) ADH_zinc_N; Zinc-binding dehydrogenase (PF00107; HMM-score: 22.9)
    NAD_binding_2; NAD binding domain of 6-phosphogluconate dehydrogenase (PF03446; HMM-score: 21.7)
    2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 20.5)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 16.9)
    Epimerase; NAD dependent epimerase/dehydratase family (PF01370; HMM-score: 15.6)
    NmrA; NmrA-like family (PF05368; HMM-score: 14)
    XdhC_C; XdhC Rossmann domain (PF13478; HMM-score: 13.6)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 11.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.179
    • Ymax_pos: 31
    • Cmax: 0.189
    • Cmax_pos: 31
    • Smax: 0.234
    • Smax_pos: 25
    • Smean: 0.125
    • D: 0.158
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446436435 NCBI
  • RefSeq: WP_000514290 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MGKEYVVIGLGRFGGSIVRELNALDMDVMAIDHDENRVNEYSDIATHAVVADTTDEAVMKSLGIRNFDHVIVAIGENIQSSTLTTLILKELGVKKVTAKAQNDYHAKILNKIGADTVVHPERDMGRRIAHNVASASVLDYLELADEHSIVELKATEKMAGQSIIDLDIRAQYGINIIAIKRGKEFIISPNPNINLEIGDILIMIGHDNDLNRFEKNIATR

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS05595 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]