From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS07945 [old locus tag: SACOL1560 ]
  • pan locus tag?: SAUPAN004070000
  • symbol: SACOL_RS07945
  • pan gene symbol?: bmfBB
  • synonym:
  • product: 2-oxoglutarate dehydrogenase E2

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS07945 [old locus tag: SACOL1560 ]
  • symbol: SACOL_RS07945
  • product: 2-oxoglutarate dehydrogenase E2
  • replicon: chromosome
  • strand: -
  • coordinates: 1595256..1596530
  • length: 1275
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1595256..1596530) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGGAAATAACAATGCCTAAGTTAGGTGAGAGTGTTCATGAAGGCACCATTGAACAATGG
    TTAGTTTCTGTTGGTGATCATATTGATGAATATGAACCATTATGTGAAGTTATTACAGAT
    AAAGTGACAGCTGAAGTCCCTTCCACGATATCAGGAACAATTACAGAAATTTTAGTTGAA
    GCGGGGCAGACAGTAGCTATTGATACAATTATCTGTAAAATTGAAACTGCTGATGAAAAG
    ACAAATGAAACAACTGAAGAGATACAAGCAAAAGTGGATGAGCATACTCAGAAATCTACT
    AAAAAAGCTAGTGCAACAGTGGAACAGACATCTACTGCTAAACAAAATCAACCACGTAAT
    AATGGTCGCTTTTCACCTGTTGTATTTAAACTCGCTTCAGAGCATGACATTGATTTATCA
    CAAGTTGTAGGTAGTGGATTTGAAGGTCGTGTAACTAAGAAGGATATAATGTCAGTTATT
    GAAAATGGTGGTACCACAGCTCAATCTGACAAACAAGTTCAAACAAAATCAACATCAGTA
    GATACATCAAGTAACCAATCATCTGAAGACAATAGTGAAAACAGCACAATACCAGTAAAT
    GGTGTGCGTAAAGCAATTGCGCAAAATATGGTTAATAGTGTAACAGAGATTCCACATGCA
    TGGATGATGATTGAAGTAGATGCTACAAATCTTGTGAAAACGAGAAATCATTATAAAAAC
    AGCTTTAAAAATAAAGAAGGATATAATCTAACGTTCTTTGCTTTCTTTGTAAAAGCTGTA
    GCAGATGCTTTAAAAGCATATCCTTTATTAAATAGTAGCTGGCAAGGAAATGAAATTGTC
    TTACATAAAGACATTAATATTTCAATTGCTGTTGCTGATGAAAATAAATTATACGTACCT
    GTGATTAAGCATGCAGACGAAAAGTCAATCAAAGGTATAGCTAGAGAAATTAATACTTTA
    GCAACGAAAGCGCGTAATAAGCAATTGACAGCTGAAGATATGCAGGGCGGTACATTTACG
    GTAAATAATACTGGTACATTTGGTTCAGTATCATCAATGGGTATTATAAATCATCCACAA
    GCAGCGATTTTACAAGTAGAATCAATCGTTAAAAAGCCAGTAGTAATTAATGATATGATT
    GCAATTCGTAACATGGTTAATTTATGTATTTCAATTGATCATCGTATTTTAGATGGTTTA
    CAAACAGGTAAATTTATGAATCATATTAAACAGCGTATCGAACAGTATACTTTAGAAAAT
    ACAAATATATATTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1275

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS07945 [old locus tag: SACOL1560 ]
  • symbol: SACOL_RS07945
  • description: 2-oxoglutarate dehydrogenase E2
  • length: 424
  • theoretical pI: 5.46533
  • theoretical MW: 46739.5
  • GRAVY: -0.34033

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase (TIGR02927; EC 2.3.1.61; HMM-score: 332.8)
    MetabolismEnergy metabolismTCA cycledihydrolipoyllysine-residue succinyltransferase, E2 component of oxoglutarate dehydrogenase (succinyl-transferring) complex (TIGR01347; EC 2.3.1.61; HMM-score: 316.3)
    MetabolismEnergy metabolismPyruvate dehydrogenasepyruvate dehydrogenase complex dihydrolipoamide acetyltransferase (TIGR01349; EC 2.3.1.12; HMM-score: 277.8)
    MetabolismEnergy metabolismPyruvate dehydrogenasedihydrolipoyllysine-residue acetyltransferase (TIGR01348; EC 2.3.1.12; HMM-score: 252.5)
    MetabolismFatty acid and phospholipid metabolismBiosynthesisacetyl-CoA carboxylase, biotin carboxyl carrier protein (TIGR00531; HMM-score: 19.1)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsoxaloacetate decarboxylase alpha subunit (TIGR01108; EC 4.1.1.3; HMM-score: 14.6)
    MetabolismEnergy metabolismOtheroxaloacetate decarboxylase alpha subunit (TIGR01108; EC 4.1.1.3; HMM-score: 14.6)
  • TheSEED:
  • PFAM:
    CoA-acyltrans (CL0149) 2-oxoacid_dh; 2-oxoacid dehydrogenases acyltransferase (catalytic domain) (PF00198; HMM-score: 272)
    Hybrid (CL0105) Biotin_lipoyl; Biotin-requiring enzyme (PF00364; HMM-score: 80.3)
    no clan definedE3_binding; e3 binding domain (PF02817; HMM-score: 42.2)
    Hybrid (CL0105) Biotin_lipoyl_2; Biotin-lipoyl like (PF13533; HMM-score: 22.4)
    HlyD_3; HlyD family secretion protein (PF13437; HMM-score: 16.4)
    GCV_H; Glycine cleavage H-protein (PF01597; HMM-score: 14.9)
    no clan definedGP70; Gene 70 protein (PF17429; HMM-score: 12.1)
    DUF2155; Uncharacterized protein conserved in bacteria (DUF2155) (PF09923; HMM-score: 9.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.099
    • Ymax_pos: 68
    • Cmax: 0.119
    • Cmax_pos: 68
    • Smax: 0.115
    • Smax_pos: 25
    • Smean: 0.069
    • D: 0.087
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446328984 NCBI
  • RefSeq: WP_000406839 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MEITMPKLGESVHEGTIEQWLVSVGDHIDEYEPLCEVITDKVTAEVPSTISGTITEILVEAGQTVAIDTIICKIETADEKTNETTEEIQAKVDEHTQKSTKKASATVEQTSTAKQNQPRNNGRFSPVVFKLASEHDIDLSQVVGSGFEGRVTKKDIMSVIENGGTTAQSDKQVQTKSTSVDTSSNQSSEDNSENSTIPVNGVRKAIAQNMVNSVTEIPHAWMMIEVDATNLVKTRNHYKNSFKNKEGYNLTFFAFFVKAVADALKAYPLLNSSWQGNEIVLHKDINISIAVADENKLYVPVIKHADEKSIKGIAREINTLATKARNKQLTAEDMQGGTFTVNNTGTFGSVSSMGIINHPQAAILQVESIVKKPVVINDMIAIRNMVNLCISIDHRILDGLQTGKFMNHIKQRIEQYTLENTNIY

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS07945 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]