From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS10895 [old locus tag: SACOL2082 ]
  • pan locus tag?: SAUPAN005371000
  • symbol: SACOL_RS10895
  • pan gene symbol?: yidC
  • synonym:
  • product: protein translocase component YidC

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS10895 [old locus tag: SACOL2082 ]
  • symbol: SACOL_RS10895
  • product: protein translocase component YidC
  • replicon: chromosome
  • strand: -
  • coordinates: 2147624..2148496
  • length: 873
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (2147624..2148496) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGAAGAAAAAAGCGTTACTACCATTATTTTTAGGTATTATGGTCTTTTTGGCTGGTTGT
    GACTATTCTAAACCTGAAAAACGTAGTGGGTTTTTCTACAATACATTCGTAGATCCAATG
    AAAAATGTATTGGATTGGTTGGGAAATAACTTATTAAACGACAATTATGGTTTAGCTATT
    ATTATCCTTGTATTGGTAATTCGTATTATTTTATTACCATTCATGTTGTCAAACTATAAA
    AATAGTCATATGATGCGTCAAAAAATGAAAGTTGCAAAGCCAGAAGTTGAAAAAATTCAA
    GAAAAAGTGAAACGTGCGCGTACACAAGAAGAAAAAATGGCTGCAAACCAAGAATTAATG
    CAAGTATATAAAAAGTATGACATGAACCCGATTAAGAGTATGTTGGGTTGTTTACCAATG
    CTAATCCAATTACCAATCATCATGGGATTATACTTTGTACTTAAAGACCAACTTGTAGAT
    GGTTTGTTTAAATATCCACACTTCTTATGGTTCGATTTAGGACGTCCTGATATTTGGATT
    ACAATTATTGCCGGTGTTTTATACTTTATCCAAGCATATGTATCAAGTAAAACGATGCCA
    GACGAACAACGTCAAATGGGTTACATGATGATGGTCATTTCACCAATTATGATTATCTGG
    ATTTCATTAAGCTCAGCATCAGCACTTGGTTTGTACTGGTCAGTCAGTGCGGCGTTCCTT
    GTAGTTCAAACACACTTTGCGAACATTTATTATGAAAAAGTCGCTAAAAAAGAAGTACAA
    CCTTTCATTGAAGCGTATGAAAGAGAGCACAACGGCGGCAGCAATAAAAAAGGCAAAAAC
    ACACAAGTTGTGTCTAAAAAGAAAAAGAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    873

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS10895 [old locus tag: SACOL2082 ]
  • symbol: SACOL_RS10895
  • description: protein translocase component YidC
  • length: 290
  • theoretical pI: 10.1207
  • theoretical MW: 33580.9
  • GRAVY: 0.0365517

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein fateProtein and peptide secretion and traffickingmembrane protein insertase, YidC/Oxa1 family (TIGR03592; HMM-score: 160.7)
  • TheSEED:
  • PFAM:
    Oxa1 (CL0376) 60KD_IMP; 60Kd inner membrane protein (PF02096; HMM-score: 151.5)
    no clan definedEI24; Etoposide-induced protein 2.4 (EI24) (PF07264; HMM-score: 20.2)
    DUF4181; Domain of unknown function (DUF4181) (PF13789; HMM-score: 13.9)
    Succ_DH_flav_C; Fumarate reductase flavoprotein C-term (PF02910; HMM-score: 13.8)
    MLANA; Protein melan-A (PF14991; HMM-score: 13.8)
    MFS (CL0015) OATP; Organic Anion Transporter Polypeptide (OATP) family (PF03137; HMM-score: 11.6)
    no clan definedDUF4446; Protein of unknown function (DUF4446) (PF14584; HMM-score: 11.5)
    Trigger_C (CL0262) SurA_N_2; SurA N-terminal domain (PF13623; HMM-score: 10.7)
    Hypoth_1 (CL0447) DUF3784; Domain of unknown function (DUF3784) (PF12650; HMM-score: 8.9)
    no clan definedDUF5325; Family of unknown function (DUF5325) (PF17259; HMM-score: 8.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 6
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.237
    • Ymax_pos: 11
    • Cmax: 0.126
    • Cmax_pos: 29
    • Smax: 0.661
    • Smax_pos: 1
    • Smean: 0.548
    • D: 0.358
  • predicted transmembrane helices (TMHMM): 6

Accession numbers[edit source | edit]

  • GI: 446648456 NCBI
  • RefSeq: WP_000725802 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKKKALLPLFLGIMVFLAGCDYSKPEKRSGFFYNTFVDPMKNVLDWLGNNLLNDNYGLAIIILVLVIRIILLPFMLSNYKNSHMMRQKMKVAKPEVEKIQEKVKRARTQEEKMAANQELMQVYKKYDMNPIKSMLGCLPMLIQLPIIMGLYFVLKDQLVDGLFKYPHFLWFDLGRPDIWITIIAGVLYFIQAYVSSKTMPDEQRQMGYMMMVISPIMIIWISLSSASALGLYWSVSAAFLVVQTHFANIYYEKVAKKEVQPFIEAYEREHNGGSNKKGKNTQVVSKKKKK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS10895 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]