From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS11000 [old locus tag: SACOL2102 ]
  • pan locus tag?: SAUPAN005401000
  • symbol: SACOL_RS11000
  • pan gene symbol?: atpI
  • synonym:
  • product: ATP synthase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS11000 [old locus tag: SACOL2102 ]
  • symbol: SACOL_RS11000
  • product: ATP synthase
  • replicon: chromosome
  • strand: -
  • coordinates: 2163262..2163714
  • length: 453
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (2163262..2163714) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    TTGAATAGAATTGACACCACAAATCGCCTATATTATCATTTAGTTTGTATGAGTGGAACG
    GTTTTCATGATTGATATCAGTCACACGGAGGCATATAAAATGAGTCGTTTCTACAACATT
    TTTAAACAGTTCATTCAATATTATTTTTATCTAATAATAATATTGGGAGGATTATACCTT
    TATACACACCATGCATTTATCTTAGGATTAATCATTGGTGTTACTGGTTCTGCAATCAAC
    ACATGTATTTTTGAATGCTATTTAGCTAAAGCTAAAAGACCAGACACTATGCATATTTCA
    ACTGGAAATATGTGGCGATACTTAGTTGCAATTATTGCCTGTATGATTTGGTACCTTAAT
    AAAGCGCATGTAAGTATCATCGGTATAATTATTGGTTTAATGATTTCATATGTTGTAGTT
    ATCATACGTCCTTTACTAAAGGTGAGCAAATAA
    60
    120
    180
    240
    300
    360
    420
    453

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS11000 [old locus tag: SACOL2102 ]
  • symbol: SACOL_RS11000
  • description: ATP synthase
  • length: 150
  • theoretical pI: 9.57806
  • theoretical MW: 17393.9
  • GRAVY: 0.703333

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:
  • PFAM:
    ATPase_I_AtpR (CL0478) ATP-synt_I; ATP synthase I chain (PF03899; HMM-score: 28.2)
    no clan definedMNHE; Na+/H+ ion antiporter subunit (PF01899; HMM-score: 14.2)
    CopD_like (CL0430) DUF4149; Domain of unknown function (DUF4149) (PF13664; HMM-score: 10.1)
    no clan definedRRM_4; RNA recognition motif of the spliceosomal PrP8 (PF10598; HMM-score: 8.9)
    GNVR; G-rich domain on putative tyrosine kinase (PF13807; HMM-score: 8.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 4
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.183
    • Ymax_pos: 34
    • Cmax: 0.276
    • Cmax_pos: 34
    • Smax: 0.299
    • Smax_pos: 6
    • Smean: 0.14
    • D: 0.166
  • predicted transmembrane helices (TMHMM): 4

Accession numbers[edit source | edit]

  • GI:
  • RefSeq: WP_001801792 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNRIDTTNRLYYHLVCMSGTVFMIDISHTEAYKMSRFYNIFKQFIQYYFYLIIILGGLYLYTHHAFILGLIIGVTGSAINTCIFECYLAKAKRPDTMHISTGNMWRYLVAIIACMIWYLNKAHVSIIGIIIGLMISYVVVIIRPLLKVSK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS11000 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]