From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS11455 [old locus tag: SACOL2177 ]
  • pan locus tag?: SAUPAN005582000
  • symbol: SACOL_RS11455
  • pan gene symbol?:
  • synonym:
  • product: zinc-binding alcohol dehydrogenase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS11455 [old locus tag: SACOL2177 ]
  • symbol: SACOL_RS11455
  • product: zinc-binding alcohol dehydrogenase
  • replicon: chromosome
  • strand: -
  • coordinates: 2258850..2259851
  • length: 1002
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (2258850..2259851) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGAAAATGATAGGATTTGAGAAGCCCTTTAAATTGGAAGAAGGAAATTTATTTAAAGTA
    TACGAACAAAGAAAGCCAACGCCAGAAAACGATGATATCTTAGTCAAAGTAAATAGCATT
    AGTGTAAATCCTGTAGATACAAAGCAACGACAAATGGAAGTCACTCAAGCACCTCGTGTA
    CTTGGGTTTGATGCTATTGGTACTGTTGAAGCTATCGGACCAGACGTTACATTATTTAGT
    CCGGGTGACGTTGTATTTTATGCTGGATCGCCAAATAGACAAGGATCAAATGCGACATAT
    CAATTGGTGTCAGAAGCTATAGTTGCAAAAGCACCACACAACATAAGTGCTAATGAAGCG
    GTTAGTCTACCGCTAACTGGTATTACGGCATATGAAACGTTTTTTGATACATTTAAAATT
    TCTACGAATCCTGCTGAAAACGAAGGGAAGTCTGTCTTAATCATTAATGGTGCCGGTGGT
    GTAGGCAGTATAGCCACTCAAATTGCTAAACGGTATGGTTTAACTGTCATTACAACAGCA
    TCACGACAAGAAACAACAGAGTGGTGTGAAAAGATGGGCGCAGATATCGTATTGAATCAT
    AAAGAGGATTTAGTGCGTCAATTTAAAGAAATTCCATTAGTAGATTATATATTTTGCACC
    TATAATACAGACTTGTATTACAATACTATGATTGAACTGATAAAACCATTAGGGCATATT
    ACGACTATCGTAGCTTTTAATGAAGATCAAGATTTAAATGCATTAAAATTAAAAAGTATA
    ACATTTACACATGAATTTATGTTTGCGCGTCCAATTCATCGAACGCCTGATATGATTAAA
    CAACATGAGTATTTAGAAGATATTACGAAAAATATAGAATCAGGGCATTACCAACCAACA
    ACGACACAAGTTTTTGAAGGTTTATCACCTGAAAACTTATATCAAGCACATCAATTGTTG
    GAAAAACAATCAATGATTGGAAAATTAGTAATTAATATATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1002

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS11455 [old locus tag: SACOL2177 ]
  • symbol: SACOL_RS11455
  • description: zinc-binding alcohol dehydrogenase
  • length: 333
  • theoretical pI: 5.09697
  • theoretical MW: 37269.2
  • GRAVY: -0.221922

Function[edit source | edit]

  • reaction:
    EC 1.1.1.1?  ExPASy
    Alcohol dehydrogenaseAn alcohol + NAD+ = an aldehyde or ketone + NADHA secondary alcohol + NAD+ = a ketone + NADH
  • TIGRFAM:
    MetabolismEnergy metabolismFermentationzinc-binding alcohol dehydrogenase family protein (TIGR02817; HMM-score: 326.8)
    Unknown functionEnzymes of unknown specificityputative NAD(P)H quinone oxidoreductase, PIG3 family (TIGR02824; HMM-score: 138.3)
    Unknown functionEnzymes of unknown specificityputative quinone oxidoreductase, YhdH/YhfP family (TIGR02823; HMM-score: 70.4)
    crotonyl-CoA carboxylase/reductase (TIGR01751; EC 1.3.1.85; HMM-score: 68.9)
    MetabolismEnergy metabolismAmino acids and aminesL-threonine 3-dehydrogenase (TIGR00692; EC 1.1.1.103; HMM-score: 39.1)
    Cellular processesCellular processesDetoxificationS-(hydroxymethyl)mycothiol dehydrogenase (TIGR03451; EC 1.1.1.306; HMM-score: 38.1)
    leukotriene B4 12-hydroxydehydrogenase/15-oxo-prostaglandin 13-reductase (TIGR02825; EC 1.3.1.48,1.3.1.74; HMM-score: 36.9)
    6-hydroxycyclohex-1-ene-1-carbonyl-CoA dehydrogenase (TIGR03201; EC 1.1.1.-; HMM-score: 32.6)
    Unknown functionEnzymes of unknown specificityNDMA-dependent alcohol dehydrogenase, Rxyl_3153 family (TIGR03989; EC 1.1.99.36; HMM-score: 32.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllchlorophyll synthesis pathway protein BchC (TIGR01202; HMM-score: 28.5)
    putative phosphonate catabolism associated alcohol dehydrogenase (TIGR03366; HMM-score: 20)
    Cellular processesCellular processesDetoxificationS-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase (TIGR02818; EC 1.1.1.1,1.1.1.284; HMM-score: 19.7)
    MetabolismEnergy metabolismFermentationS-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase (TIGR02818; EC 1.1.1.1,1.1.1.284; HMM-score: 19.7)
    MetabolismEnergy metabolismFermentationzinc-binding alcohol dehydrogenase family protein (TIGR02822; EC 1.-.-.-; HMM-score: 18.9)
    acetyl coenzyme A synthetase (ADP forming), alpha domain (TIGR02717; EC 6.2.1.13; HMM-score: 14.8)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) ADH_zinc_N; Zinc-binding dehydrogenase (PF00107; HMM-score: 54.2)
    ADH_zinc_N_2; Zinc-binding dehydrogenase (PF13602; HMM-score: 49.2)
    GroES (CL0296) ADH_N; Alcohol dehydrogenase GroES-like domain (PF08240; HMM-score: 29.4)
    NADP_Rossmann (CL0063) AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 17.7)
    2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 13.1)
    CMAS; Mycolic acid cyclopropane synthetase (PF02353; HMM-score: 11.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.121
    • Ymax_pos: 11
    • Cmax: 0.112
    • Cmax_pos: 51
    • Smax: 0.24
    • Smax_pos: 2
    • Smean: 0.132
    • D: 0.126
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446704599 NCBI
  • RefSeq: WP_000781945 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKMIGFEKPFKLEEGNLFKVYEQRKPTPENDDILVKVNSISVNPVDTKQRQMEVTQAPRVLGFDAIGTVEAIGPDVTLFSPGDVVFYAGSPNRQGSNATYQLVSEAIVAKAPHNISANEAVSLPLTGITAYETFFDTFKISTNPAENEGKSVLIINGAGGVGSIATQIAKRYGLTVITTASRQETTEWCEKMGADIVLNHKEDLVRQFKEIPLVDYIFCTYNTDLYYNTMIELIKPLGHITTIVAFNEDQDLNALKLKSITFTHEFMFARPIHRTPDMIKQHEYLEDITKNIESGHYQPTTTQVFEGLSPENLYQAHQLLEKQSMIGKLVINI

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS11455 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]