From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS14300 [old locus tag: SACOL2736 ]
  • pan locus tag?: SAUPAN006487000
  • symbol: SACOL_RS14300
  • pan gene symbol?: gidB
  • synonym:
  • product: ribosomal RNA small subunit methyltransferase G

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS14300 [old locus tag: SACOL2736 ]
  • symbol: SACOL_RS14300
  • product: ribosomal RNA small subunit methyltransferase G
  • replicon: chromosome
  • strand: -
  • coordinates: 2804443..2805162
  • length: 720
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (2804443..2805162) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGACTGTAGAATGGTTAGCAGAACAATTAAAAGAACATAATATTCAATTAACTGAGACT
    CAAAAACAACAGTTTCAAACATATTATCGTTTACTTGTTGAATGGAATGAAAAGATGAAT
    TTGACAAGTATTACAGATGAACACGATGTATATTTGAAACATTTTTATGATTCCATTGCA
    CCTAGTTTTTATTTTGATTTTAATCAGCCTATAAGTATATGTGATGTAGGCGCTGGAGCT
    GGTTTTCCAAGTATTCCGTTAAAAATAATGTTTCCGCAGTTAAAAGTGACGATTGTTGAT
    TCATTAAATAAGCGTATTCAATTTTTAAACCATTTAGCGTCAGAATTACAATTACAGGAT
    GTCAGCTTTATACACGATAGAGCAGAAACATTTGGTAAGGGTGTCTACAGGGAGTCTTAT
    GATGTTGTTACTGCAAGAGCAGTAGCTAGATTATCCGTGTTAAGTGAATTGTGTTTACCG
    CTAGTTAAAAAAGGTGGACAGTTTGTTGCATTAAAATCTTCAAAAGGTGAAGAAGAATTA
    GAAGAAGCAAAATTTGCAATTAGTGTGTTAGGTGGTAATGTTACAGAAACACATACCTTT
    GAATTGCCAGAAGATGCTGGAGAGCGCCAGATGTTCATTATTGATAAAAAAAGACAGACG
    CCGAAAAAGTATCCAAGAAAACCAGGGACGCCTAATAAGACTCCTTTACTTGAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS14300 [old locus tag: SACOL2736 ]
  • symbol: SACOL_RS14300
  • description: ribosomal RNA small subunit methyltransferase G
  • length: 239
  • theoretical pI: 6.52152
  • theoretical MW: 27359.1
  • GRAVY: -0.37113

Function[edit source | edit]

  • reaction:
    EC 2.1.1.-?  ExPASy
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modification16S rRNA (guanine(527)-N(7))-methyltransferase RsmG (TIGR00138; EC 2.1.1.170; HMM-score: 174.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone3-demethylubiquinone-9 3-O-methyltransferase (TIGR01983; EC 2.1.1.64; HMM-score: 28.9)
    Genetic information processingProtein fateProtein modification and repairprotein-(glutamine-N5) methyltransferase, release factor-specific (TIGR03534; EC 2.1.1.-; HMM-score: 22.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprecorrin-6Y C5,15-methyltransferase (decarboxylating), CbiT subunit (TIGR02469; EC 2.1.1.132; HMM-score: 20.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersBiotinmalonyl-acyl carrier protein O-methyltransferase BioC (TIGR02072; EC 2.1.1.-; HMM-score: 20.2)
    Genetic information processingProtein fateProtein modification and repairmethyltransferase, HemK family (TIGR00536; HMM-score: 17.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllC-20 methyltransferase BchU (TIGR02716; EC 2.1.1.-; HMM-score: 16)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone/menaquinone biosynthesis methyltransferase (TIGR01934; EC 2.1.1.-; HMM-score: 14.1)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) GidB; rRNA small subunit methyltransferase G (PF02527; HMM-score: 195.5)
    Methyltransf_31; Methyltransferase domain (PF13847; HMM-score: 33.2)
    Methyltransf_25; Methyltransferase domain (PF13649; HMM-score: 24.9)
    MTS; Methyltransferase small domain (PF05175; HMM-score: 17.7)
    Methyltransf_32; Methyltransferase domain (PF13679; HMM-score: 16.2)
    Methyltransf_12; Methyltransferase domain (PF08242; HMM-score: 15.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.095
    • Ymax_pos: 26
    • Cmax: 0.106
    • Cmax_pos: 24
    • Smax: 0.104
    • Smax_pos: 18
    • Smean: 0.081
    • D: 0.089
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446137740 NCBI
  • RefSeq: WP_000215595 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTVEWLAEQLKEHNIQLTETQKQQFQTYYRLLVEWNEKMNLTSITDEHDVYLKHFYDSIAPSFYFDFNQPISICDVGAGAGFPSIPLKIMFPQLKVTIVDSLNKRIQFLNHLASELQLQDVSFIHDRAETFGKGVYRESYDVVTARAVARLSVLSELCLPLVKKGGQFVALKSSKGEEELEEAKFAISVLGGNVTETHTFELPEDAGERQMFIIDKKRQTPKKYPRKPGTPNKTPLLEK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS14300 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]