From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00076
  • pan locus tag?: SAUPAN000915000
  • symbol: SAOUHSC_00076
  • pan gene symbol?: sbnB
  • synonym:
  • product: 2,3-diaminopropionate biosynthesis protein SbnB

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00076
  • symbol: SAOUHSC_00076
  • product: 2,3-diaminopropionate biosynthesis protein SbnB
  • replicon: chromosome
  • strand: +
  • coordinates: 80727..81737
  • length: 1011
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGAATAGAGAGATGTTGTATTTAAATAGATCAGATATTGAACAAGCGGGAGGTAATCAT
    TCACAAGTTTATGTGGACGCATTAACAGAAGCATTAACAGCCCATGCGCACAATGATTTT
    GTACAACCGCTTAAGCCGTATTTAAGACAGGATCCTGAAAATGGACACATCGCAGATCGA
    ATTATTGCAATGCCAAGTCATATCGGTGGTGAACACGCAATTTCAGGTATTAAGTGGATA
    GGTAGTAAGCACGACAATCCATCGAAACGTAATATGGAGCGTGCAAGTGGCGTCATTATT
    TTGAATGATCCAGAAACGAATTATCCAATTGCAGTTATGGAAGCAAGTTTAATTAGTAGT
    ATGCGTACTGCAGCAGTTTCAGTGATTGCAGCAAAGCATTTGGCTAAAAAAGGATTTAAA
    GACTTAACAATCATTGGATGCGGGCTAATCGGAGACAAGCAATTACAAAGTATGTTAGAG
    CAATTCGATCATATTGAACGCGTGTTTGTTTACGATCAATTCTCTGAAGCATGTGCACGC
    TTTGTTGATAGATGGCAACAACAGCGTCCGGAAATTAATTTTATTGCGACAGAAAATGCT
    AAAGAAGCAGTATCAAATGGTGAAGTAGTCATTACATGTACCGTAACGGATCAACCATAC
    ATTGAATATGATTGGTTACAAAAGGGTGCATTTATTAGCAACATTTCTATCATGGATGTG
    CATAAAGAAGTCTTTATTAAAGCTGACAAAGTCGTAGTAGATGACTGGTCACAATGTAAT
    CGAGAAAAGAAAACTATTAACCAATTGGTGTTAGAAGGTAAATTCAGCAAAGAAGCTCTT
    CATGCTGAACTAGGACAACTTGTGACAGGTGACATACCAGGACGTGAAGACGATGATGAG
    ATCATATTACTTAATCCGATGGGTATGGCTATCGAAGATATTTCAAGTGCTTATTTTATT
    TATCAACAGGCACAACAACAAAATATTGGGACAACATTGAACCTATATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1011

Protein[edit source | edit]

Protein Data Bank: 4M54
Protein Data Bank: 4MP3
Protein Data Bank: 4MP6
Protein Data Bank: 4MP8
Protein Data Bank: 4MPD

General[edit source | edit]

  • locus tag: SAOUHSC_00076
  • symbol: SAOUHSC_00076
  • description: 2,3-diaminopropionate biosynthesis protein SbnB
  • length: 336
  • theoretical pI: 4.91313
  • theoretical MW: 37748.5
  • GRAVY: -0.291369

Function[edit source | edit]

  • reaction:
    EC 4.3.1.12?  ExPASy
    Ornithine cyclodeaminaseL-ornithine = L-proline + NH3
  • TIGRFAM:
    Cellular processesCellular processesBiosynthesis of natural products2,3-diaminopropionate biosynthesis protein SbnB (TIGR03944; HMM-score: 420.9)
    alanine dehydrogenase (TIGR02371; EC 1.4.1.1; HMM-score: 191.5)
    ectoine utilization protein EutC (TIGR02992; HMM-score: 100)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminglutamyl-tRNA reductase (TIGR01035; EC 1.2.1.70; HMM-score: 15.9)
  • TheSEED:  
    Arginine and Ornithine Degradation Ornithine cyclodeaminase (EC 4.3.1.12) / Siderophore staphylobactin biosynthesis protein SbnB 
    Proline, 4-hydroxyproline uptake and utilization Ornithine cyclodeaminase (EC 4.3.1.12) / Siderophore staphylobactin biosynthesis protein SbnB 
    Siderophore Staphylobactin Ornithine cyclodeaminase (EC 4.3.1.12) / Siderophore staphylobactin biosynthesis protein SbnB 
    Threonine degradation Ornithine cyclodeaminase (EC 4.3.1.12) / Siderophore staphylobactin biosynthesis protein SbnB 
  • PFAM:
    NADP_Rossmann (CL0063) OCD_Mu_crystall; Ornithine cyclodeaminase/mu-crystallin family (PF02423; HMM-score: 218.2)
    Shikimate_DH; Shikimate / quinate 5-dehydrogenase (PF01488; HMM-score: 23.2)
    GFO_IDH_MocA; Oxidoreductase family, NAD-binding Rossmann fold (PF01408; HMM-score: 16.1)
    Ig (CL0011) Ig_3; Immunoglobulin domain (PF13927; HMM-score: 14)
    NADP_Rossmann (CL0063) Sacchrp_dh_NADP; Saccharopine dehydrogenase NADP binding domain (PF03435; HMM-score: 13.9)
    THF_DHG_CYH_C; Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (PF02882; HMM-score: 12.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.139
    • Ymax_pos: 37
    • Cmax: 0.227
    • Cmax_pos: 37
    • Smax: 0.153
    • Smax_pos: 1
    • Smean: 0.089
    • D: 0.119
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNREMLYLNRSDIEQAGGNHSQVYVDALTEALTAHAHNDFVQPLKPYLRQDPENGHIADRIIAMPSHIGGEHAISGIKWIGSKHDNPSKRNMERASGVIILNDPETNYPIAVMEASLISSMRTAAVSVIAAKHLAKKGFKDLTIIGCGLIGDKQLQSMLEQFDHIERVFVYDQFSEACARFVDRWQQQRPEINFIATENAKEAVSNGEVVITCTVTDQPYIEYDWLQKGAFISNISIMDVHKEVFIKADKVVVDDWSQCNREKKTINQLVLEGKFSKEALHAELGQLVTGDIPGREDDDEIILLNPMGMAIEDISSAYFIYQQAQQQNIGTTLNLY

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SAOUHSC_01592 (Fur*)
    Fur* (TF) important in Iron homeostasis

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-3661
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]

Suzanne E Dale, Amanda Doherty-Kirby, Gilles Lajoie, David E Heinrichs
Role of siderophore biosynthesis in virulence of Staphylococcus aureus: identification and characterization of genes involved in production of a siderophore.
Infect. Immun.: 2004, 72(1);29-37
[PubMed:14688077] [WorldCat.org] (P p)