From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00094
  • pan locus tag?: SAUPAN000943000
  • symbol: SAOUHSC_00094
  • pan gene symbol?: sasD
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00094
  • symbol: SAOUHSC_00094
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 100455..101054
  • length: 600
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGAAAAAATTAGCAACAGTAGGTTCTTTAATTGTAACAAGCACTTTAGTATTCTCAAGT
    ATGCCTTTTCAAAATGCGCATGCCGACACAACTTCAATGAATGTGTCGAATAAACAAAGC
    CAAAATGTACAAAATCATCGTCCTTATGGCGGAGTAGTACCACAAGGAATGACGCAAGCA
    CAATATACTGAATTAGAGAAAGCTTTACCCCAATTAAGCGCTGGCAGTAATATGCAAGAC
    TATAATATGAAATTGTATGATGCGACGCAAAATATTGCTGATAAATACAATGTGATAATT
    ACAACTAATGTAGGGGTATTTAAACCACATGCTGTTAGAGATATGAATGGCCATGCGTTA
    CCTTTAACAAAAGATGGCAATTTTTATCAAACGAATGTAGATGCAAATGGTGTTAATCAT
    GGTGGTAGTGAAATGGTGCAAAATAAAACAGGTCATATGAGTCAACAAGGCCATATGAAT
    CAGAACACACATGAACCAACAGCCACACATGCAACAAGGTCATATGCAATCATCAAACCA
    TCAAATGATGAGTCCAAAAGCAAATATGCATTCATCAAATCATCAAATGAACCAAAGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_00094
  • symbol: SAOUHSC_00094
  • description: hypothetical protein
  • length: 199
  • theoretical pI: 9.46569
  • theoretical MW: 21847.2
  • GRAVY: -0.700503

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:  
    Virulence, Disease and DefenseAdhesionAdhesins in Staphylococcus Predicted cell-wall-anchored protein SasD (LPXAG motif) 
  • PFAM:

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cellwall
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 9.94
    • Extracellular Score: 0.06
    • Internal Helices: 0
  • LocateP: N-terminally anchored (with CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: -0.17
    • Signal Peptide Possibility: 1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: QNAHADTT
  • SignalP: Signal peptide length 29 aa
    • Ymax: 0.862
    • Ymax_pos: 29
    • Cmax: 0.82
    • Cmax_pos: 29
    • Smax: 0.953
    • Smax_pos: 19
    • Smean: 0.894
    • D: 0.874
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKKLATVGSLIVTSTLVFSSMPFQNAHADTTSMNVSNKQSQNVQNHRPYGGVVPQGMTQAQYTELEKALPQLSAGSNMQDYNMKLYDATQNIADKYNVIITTNVGVFKPHAVRDMNGHALPLTKDGNFYQTNVDANGVNHGGSEMVQNKTGHMSQQGHMNQNTHEPTATHATRSYAIIKPSNDESKSKYAFIKSSNEPK

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]