From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00188
  • pan locus tag?: SAUPAN001083000
  • symbol: SAOUHSC_00188
  • pan gene symbol?: pflA
  • synonym:
  • product: pyruvate formate-lyase 1 activating enzyme

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00188
  • symbol: SAOUHSC_00188
  • product: pyruvate formate-lyase 1 activating enzyme
  • replicon: chromosome
  • strand: +
  • coordinates: 208180..208935
  • length: 756
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGCTTAAGGGACACTTACATTCTGTCGAAAGTTTAGGTACTGTCGATGGACCGGGATTA
    AGATATATATTATTTACACAAGGATGCTTACTTAGATGCTTGTATTGCCACAATCCAGAT
    ACTTGGAAAATTAGTGAGCCATCAAGAGAAGTCACAGTTGATGAAATGGTGAATGAAATA
    TTACCATACAAACCATACTTTGATGCATCGGGTGGCGGTGTAACAGTCAGTGGTGGCGAA
    CCATTGTTACAAATGCCATTCTTAGAAAAATTATTTGCAGAATTAAAAGAAAATGGTGTG
    CACACTTGCTTAGACACATCGGCTGGATGTGCTAATGATACAAAAGCATTTCAAAGGCAT
    TTTGAAGAATTACAAAAACATACAGACTTGATATTATTAGATATAAAACATATTGATAAT
    GACAAACATATTAGATTGACAGGAAAGCCTAATACACACATCCTTAACTTCGCGCGCAAA
    CTGTCAGATATGAAACAACCTGTATGGATTCGACATGTCCTTGTGCCTGGTTATTCTGAT
    GATAAAGACGATTTAATTAAACTAGGGGAATTTATTAATTCTCTTGATAACGTCGAAAAG
    TTTGAAATTCTGCCATATCATCAGTTAGGTGTTCATAAGTGGAAAACATTGGGCATTGCA
    TATGAATTAGAAGATGTCGAAGCGCCCGATGATGAAGCTGTTAAAGCAGCCTACCGTTAT
    GTTAACTTCAAAGGGAAAATTCCCGTTGAATTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    756

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_00188
  • symbol: SAOUHSC_00188
  • description: pyruvate formate-lyase 1 activating enzyme
  • length: 251
  • theoretical pI: 5.9116
  • theoretical MW: 28498.4
  • GRAVY: -0.319124

Function[edit source | edit]

  • reaction:
    EC 1.97.1.4?  ExPASy
    [Formate-C-acetyltransferase]-activating enzymeS-adenosyl-L-methionine + dihydroflavodoxin + [formate C-acetyltransferase]-glycine = 5'-deoxyadenosine + L-methionine + flavodoxin semiquinone + [formate C-acetyltransferase]-glycin-2-yl radical
  • TIGRFAM:
    Genetic information processingProtein fateProtein modification and repairpyruvate formate-lyase 1-activating enzyme (TIGR02493; EC 1.97.1.4; HMM-score: 320.7)
    MetabolismEnergy metabolismAnaerobicpyruvate formate-lyase 1-activating enzyme (TIGR02493; EC 1.97.1.4; HMM-score: 320.7)
    glycyl-radical enzyme activating protein (TIGR02494; EC 1.97.1.-; HMM-score: 195.8)
    MetabolismEnergy metabolismAmino acids and aminescholine TMA-lyase-activating enzyme (TIGR04395; EC 1.97.-.-; HMM-score: 154.8)
    Genetic information processingProtein fateProtein modification and repairglycine radical enzyme activase, YjjW family (TIGR04041; EC 1.97.1.-; HMM-score: 133.4)
    Genetic information processingProtein fateProtein modification and repair[benzylsuccinate synthase]-activating enzyme (TIGR04003; EC 1.97.-.-; HMM-score: 127.2)
    Genetic information processingProtein fateProtein modification and repairanaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 64.4)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotides2'-Deoxyribonucleotide metabolismanaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 64.4)
    Genetic information processingProtein fateProtein modification and repairanaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02491; EC 1.97.1.-; HMM-score: 55)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotides2'-Deoxyribonucleotide metabolismanaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02491; EC 1.97.1.-; HMM-score: 55)
    His-Xaa-Ser system radical SAM maturase HxsC (TIGR03977; HMM-score: 33.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercoenzyme PQQ biosynthesis enzyme PqqE (TIGR02109; HMM-score: 30)
    putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR04349; HMM-score: 29.3)
    radical SAM protein, TatD family-associated (TIGR04038; HMM-score: 29.1)
    Genetic information processingProtein synthesistRNA and rRNA base modification7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR03365; HMM-score: 25.7)
    Genetic information processingProtein synthesistRNA and rRNA base modificationputative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR03963; HMM-score: 25.6)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotides2'-Deoxyribonucleotide metabolismanaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02826; EC 1.97.1.-; HMM-score: 25)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMolybdopterinmolybdenum cofactor biosynthesis protein A (TIGR02666; HMM-score: 24.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMolybdopterinprobable molybdenum cofactor biosynthesis protein A (TIGR02668; HMM-score: 22.1)
    AmmeMemoRadiSam system radical SAM enzyme (TIGR04337; HMM-score: 21.9)
    putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR04322; HMM-score: 17.1)
    SynChlorMet cassette radical SAM/SPASM protein ScmF (TIGR04251; HMM-score: 16.5)
    putative peptide-modifying radical SAM enzyme, Mhun_1560 family (TIGR04083; HMM-score: 15.6)
    Signal transductionRegulatory functionsProtein interactionspeptide modification radical SAM enzyme, YydG family (TIGR04078; HMM-score: 14.9)
    Cellular processesCellular processesToxin production and resistanceCys-rich peptide radical SAM maturase CcpM (TIGR04068; HMM-score: 14.6)
    radical SAM peptide maturase, GG-Bacteroidales family (TIGR04148; HMM-score: 14.6)
    putative geopeptide radical SAM maturase (TIGR04280; HMM-score: 14.1)
    radical SAM peptide maturase, CXXX-repeat target family (TIGR04115; HMM-score: 13.4)
    Cellular processesCellular processesToxin production and resistancetryptophan 2-C-methyltransferase (TIGR04428; EC 2.1.1.106; HMM-score: 12.1)
    SynChlorMet cassette radical SAM/SPASM protein ScmE (TIGR04250; HMM-score: 12)
    His-Xaa-Ser system radical SAM maturase HxsB (TIGR03978; HMM-score: 10.5)
    Cellular processesCellular processesToxin production and resistancenif11-like peptide radical SAM maturase (TIGR04064; HMM-score: 9.6)
  • TheSEED:  
    CarbohydratesFermentationFermentations: Mixed acid Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) 
    RespirationRespiration - no subcategoryFormate hydrogenase Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) 
  • PFAM:
    TIM_barrel (CL0036) Radical_SAM; Radical SAM superfamily (PF04055; HMM-score: 94.8)
    4Fe-4S (CL0344) Fer4_12; 4Fe-4S single cluster domain (PF13353; HMM-score: 65.2)
    Fer4_14; 4Fe-4S single cluster domain (PF13394; HMM-score: 36.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: [4Fe-4S] cluster
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.127
    • Ymax_pos: 45
    • Cmax: 0.116
    • Cmax_pos: 45
    • Smax: 0.201
    • Smax_pos: 1
    • Smean: 0.105
    • D: 0.118
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MLKGHLHSVESLGTVDGPGLRYILFTQGCLLRCLYCHNPDTWKISEPSREVTVDEMVNEILPYKPYFDASGGGVTVSGGEPLLQMPFLEKLFAELKENGVHTCLDTSAGCANDTKAFQRHFEELQKHTDLILLDIKHIDNDKHIRLTGKPNTHILNFARKLSDMKQPVWIRHVLVPGYSDDKDDLIKLGEFINSLDNVEKFEILPYHQLGVHKWKTLGIAYELEDVEAPDDEAVKAAYRYVNFKGKIPVEL

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-3661
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]