From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00188
  • pan locus tag?: SAUPAN001083000
  • symbol: SAOUHSC_00188
  • pan gene symbol?: pflA
  • synonym:
  • product: pyruvate formate-lyase 1 activating enzyme

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_00188
  • symbol: SAOUHSC_00188
  • product: pyruvate formate-lyase 1 activating enzyme
  • replicon: chromosome
  • strand: +
  • coordinates: 208180..208935
  • length: 756
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGCTTAAGGGACACTTACATTCTGTCGAAAGTTTAGGTACTGTCGATGGACCGGGATTA
    AGATATATATTATTTACACAAGGATGCTTACTTAGATGCTTGTATTGCCACAATCCAGAT
    ACTTGGAAAATTAGTGAGCCATCAAGAGAAGTCACAGTTGATGAAATGGTGAATGAAATA
    TTACCATACAAACCATACTTTGATGCATCGGGTGGCGGTGTAACAGTCAGTGGTGGCGAA
    CCATTGTTACAAATGCCATTCTTAGAAAAATTATTTGCAGAATTAAAAGAAAATGGTGTG
    CACACTTGCTTAGACACATCGGCTGGATGTGCTAATGATACAAAAGCATTTCAAAGGCAT
    TTTGAAGAATTACAAAAACATACAGACTTGATATTATTAGATATAAAACATATTGATAAT
    GACAAACATATTAGATTGACAGGAAAGCCTAATACACACATCCTTAACTTCGCGCGCAAA
    CTGTCAGATATGAAACAACCTGTATGGATTCGACATGTCCTTGTGCCTGGTTATTCTGAT
    GATAAAGACGATTTAATTAAACTAGGGGAATTTATTAATTCTCTTGATAACGTCGAAAAG
    TTTGAAATTCTGCCATATCATCAGTTAGGTGTTCATAAGTGGAAAACATTGGGCATTGCA
    TATGAATTAGAAGATGTCGAAGCGCCCGATGATGAAGCTGTTAAAGCAGCCTACCGTTAT
    GTTAACTTCAAAGGGAAAATTCCCGTTGAATTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    756

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAOUHSC_00188
  • symbol: SAOUHSC_00188
  • description: pyruvate formate-lyase 1 activating enzyme
  • length: 251
  • theoretical pI: 5.9116
  • theoretical MW: 28498.4
  • GRAVY: -0.319124

⊟Function[edit | edit source]

  • reaction:
    EC 1.97.1.4?  ExPASy
    [Formate-C-acetyltransferase]-activating enzyme S-adenosyl-L-methionine + dihydroflavodoxin + [formate C-acetyltransferase]-glycine = 5'-deoxyadenosine + L-methionine + flavodoxin semiquinone + [formate C-acetyltransferase]-glycin-2-yl radical
  • TIGRFAM:
    Genetic information processing Protein fate Protein modification and repair pyruvate formate-lyase 1-activating enzyme (TIGR02493; EC 1.97.1.4; HMM-score: 320.7)
    Metabolism Energy metabolism Anaerobic pyruvate formate-lyase 1-activating enzyme (TIGR02493; EC 1.97.1.4; HMM-score: 320.7)
    and 30 more
    glycyl-radical enzyme activating protein (TIGR02494; EC 1.97.1.-; HMM-score: 195.8)
    Metabolism Energy metabolism Amino acids and amines choline TMA-lyase-activating enzyme (TIGR04395; EC 1.97.-.-; HMM-score: 154.8)
    Genetic information processing Protein fate Protein modification and repair glycine radical enzyme activase, YjjW family (TIGR04041; EC 1.97.1.-; HMM-score: 133.4)
    Genetic information processing Protein fate Protein modification and repair [benzylsuccinate synthase]-activating enzyme (TIGR04003; EC 1.97.-.-; HMM-score: 127.2)
    Genetic information processing Protein fate Protein modification and repair anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 64.4)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides 2'-Deoxyribonucleotide metabolism anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 64.4)
    Genetic information processing Protein fate Protein modification and repair anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02491; EC 1.97.1.-; HMM-score: 55)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides 2'-Deoxyribonucleotide metabolism anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02491; EC 1.97.1.-; HMM-score: 55)
    His-Xaa-Ser system radical SAM maturase HxsC (TIGR03977; HMM-score: 33.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other coenzyme PQQ biosynthesis enzyme PqqE (TIGR02109; HMM-score: 30)
    putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR04349; HMM-score: 29.3)
    radical SAM protein, TatD family-associated (TIGR04038; HMM-score: 29.1)
    Genetic information processing Protein synthesis tRNA and rRNA base modification 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR03365; HMM-score: 25.7)
    Genetic information processing Protein synthesis tRNA and rRNA base modification putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR03963; HMM-score: 25.6)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides 2'-Deoxyribonucleotide metabolism anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02826; EC 1.97.1.-; HMM-score: 25)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin molybdenum cofactor biosynthesis protein A (TIGR02666; HMM-score: 24.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin probable molybdenum cofactor biosynthesis protein A (TIGR02668; HMM-score: 22.1)
    AmmeMemoRadiSam system radical SAM enzyme (TIGR04337; HMM-score: 21.9)
    putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR04322; HMM-score: 17.1)
    SynChlorMet cassette radical SAM/SPASM protein ScmF (TIGR04251; HMM-score: 16.5)
    putative peptide-modifying radical SAM enzyme, Mhun_1560 family (TIGR04083; HMM-score: 15.6)
    Signal transduction Regulatory functions Protein interactions peptide modification radical SAM enzyme, YydG family (TIGR04078; HMM-score: 14.9)
    Cellular processes Cellular processes Toxin production and resistance Cys-rich peptide radical SAM maturase CcpM (TIGR04068; HMM-score: 14.6)
    radical SAM peptide maturase, GG-Bacteroidales family (TIGR04148; HMM-score: 14.6)
    putative geopeptide radical SAM maturase (TIGR04280; HMM-score: 14.1)
    radical SAM peptide maturase, CXXX-repeat target family (TIGR04115; HMM-score: 13.4)
    Cellular processes Cellular processes Toxin production and resistance tryptophan 2-C-methyltransferase (TIGR04428; EC 2.1.1.106; HMM-score: 12.1)
    SynChlorMet cassette radical SAM/SPASM protein ScmE (TIGR04250; HMM-score: 12)
    His-Xaa-Ser system radical SAM maturase HxsB (TIGR03978; HMM-score: 10.5)
    Cellular processes Cellular processes Toxin production and resistance nif11-like peptide radical SAM maturase (TIGR04064; HMM-score: 9.6)
  • TheSEED  :
    • Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
    Carbohydrates Fermentation Fermentations: Mixed acid  Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
    and 1 more
    Respiration Respiration - no subcategory Formate hydrogenase  Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
  • PFAM:
    TIM_barrel (CL0036) Radical_SAM; Radical SAM superfamily (PF04055; HMM-score: 94.8)
    and 2 more
    4Fe-4S (CL0344) Fer4_12; 4Fe-4S single cluster domain (PF13353; HMM-score: 65.2)
    Fer4_14; 4Fe-4S single cluster domain (PF13394; HMM-score: 36.5)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors: [4Fe-4S] cluster
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.04507
    • TAT(Tat/SPI): 0.001294
    • LIPO(Sec/SPII): 0.124692
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MLKGHLHSVESLGTVDGPGLRYILFTQGCLLRCLYCHNPDTWKISEPSREVTVDEMVNEILPYKPYFDASGGGVTVSGGEPLLQMPFLEKLFAELKENGVHTCLDTSAGCANDTKAFQRHFEELQKHTDLILLDIKHIDNDKHIRLTGKPNTHILNFARKLSDMKQPVWIRHVLVPGYSDDKDDLIKLGEFINSLDNVEKFEILPYHQLGVHKWKTLGIAYELEDVEAPDDEAVKAAYRYVNFKGKIPVEL

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas [1] [2]
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulators: CcpA* regulon, Rex* (repression) regulon
    CcpA*(TF)important in Carbon catabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise 
    Rex*(TF)important in Energy metabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise 

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. ↑ 3.0 3.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=SAOUHSC_00188&oldid=80143"