From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00217
  • pan locus tag?: SAUPAN001120000
  • symbol: SAOUHSC_00217
  • pan gene symbol?:
  • synonym:
  • product: sorbitol dehydrogenase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00217
  • symbol: SAOUHSC_00217
  • product: sorbitol dehydrogenase
  • replicon: chromosome
  • strand: +
  • coordinates: 237129..238184
  • length: 1056
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    GTGAAAGCTTTAGTAAAAACAAGAGAAGGACATGGCAACTTAGAACTTCTTGATAAAGAA
    GTTGCAACACCGCTAGATGATAAAGTAAAGATTAAAGTACATTATGCAGGAATTTGTGGC
    ACAGATATTCATACTTATGAAGGTCATTATAAAGTTAATTTTCCAGTGACATTAGGTCAT
    GAATTTTCTGGTGAAATCGTTGAAGTTGGAGCAGACGTTAAAGATTTTAAAGTTGGTGAC
    CGTGTCACATCTGAAACGACATTCTATGTTTGTAATGAGTGTGAATACTGTAAATCAAAA
    GACTATAATTTATGCAACCATCGAAAAGGTATTGGAACACAAGTTGATGGCGCATTTACT
    AATTATGTCATTGCACGTGAAGAAAGTTTGCATCATATTCCAGACGAAGTATCGTATCAG
    TCTGCAGCTATGACAGAACCATTAGCATGTGCACATCATGGCGTTTCTAAGATTCAAGTC
    AATTCAGGCGATGTAGCAGTTGTAATGGGACCTGGGCCAATCGGATTACTTGTAGCACAA
    GTGTTAAAAAGTAAAGGCGCAACTGTTGTGGTAACTGGATTGGACAATGACAAAGTCAGA
    TTAGATAAAGCAGAAGCATTGCACATGGATTATGTAGTCAATTTACAACAAACAGACTTA
    AAAACGTATATCAATGGAATTACAGACGGTTACGGTGCAGATGTTGTTGTTGAATGTTCA
    GGTGCAGTTCCAGCAGCACGACAAGGTTTGGATATTTTACGCAAAAAAGGTTTCTACAGT
    CAAATAGGTATTTTTAAGGATGCTGAAATTCCATTTGATATGGAAAAAGTGATTCAAAAA
    GAAATAACAGTTGTTGGTAGTAGAAGTCAAAAGCCAGCAGATTGGGAACCTTCATTGCAA
    CTTATGGCGGATGGTTTAGTAAATGCTGAAGCTTTGGTGACAAAAATATATGATATTTCG
    AAATGGGACGAGGCGTATCAACATTTAAAATCCGGCGAAGGTATTAAAGCATTACTTAAG
    CCGCTCGATTTAGATGAAAATGAAGGAGAGAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1056

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_00217
  • symbol: SAOUHSC_00217
  • description: sorbitol dehydrogenase
  • length: 351
  • theoretical pI: 5.05273
  • theoretical MW: 38456.4
  • GRAVY: -0.245014

Function[edit source | edit]

  • reaction:
    EC 1.1.1.14?  ExPASy
    L-iditol 2-dehydrogenaseL-iditol + NAD+ = L-sorbose + NADH
  • TIGRFAM:
    MetabolismEnergy metabolismAmino acids and aminesL-threonine 3-dehydrogenase (TIGR00692; EC 1.1.1.103; HMM-score: 220.8)
    Unknown functionEnzymes of unknown specificityNDMA-dependent alcohol dehydrogenase, Rxyl_3153 family (TIGR03989; EC 1.1.99.36; HMM-score: 118.6)
    putative phosphonate catabolism associated alcohol dehydrogenase (TIGR03366; HMM-score: 111.8)
    Unknown functionEnzymes of unknown specificityputative NAD(P)H quinone oxidoreductase, PIG3 family (TIGR02824; HMM-score: 106.3)
    6-hydroxycyclohex-1-ene-1-carbonyl-CoA dehydrogenase (TIGR03201; EC 1.1.1.-; HMM-score: 97.8)
    MetabolismEnergy metabolismFermentationzinc-binding alcohol dehydrogenase family protein (TIGR02822; EC 1.-.-.-; HMM-score: 94.4)
    Cellular processesCellular processesDetoxificationS-(hydroxymethyl)mycothiol dehydrogenase (TIGR03451; EC 1.1.1.306; HMM-score: 91.8)
    Cellular processesCellular processesDetoxificationS-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase (TIGR02818; EC 1.1.1.1,1.1.1.284; HMM-score: 83.7)
    MetabolismEnergy metabolismFermentationS-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase (TIGR02818; EC 1.1.1.1,1.1.1.284; HMM-score: 83.7)
    MetabolismCentral intermediary metabolismOne-carbon metabolismformaldehyde dehydrogenase, glutathione-independent (TIGR02819; EC 1.2.1.46; HMM-score: 74.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllchlorophyll synthesis pathway protein BchC (TIGR01202; HMM-score: 58.8)
    crotonyl-CoA carboxylase/reductase (TIGR01751; EC 1.3.1.85; HMM-score: 34.5)
    Unknown functionEnzymes of unknown specificityputative quinone oxidoreductase, YhdH/YhfP family (TIGR02823; HMM-score: 29.4)
    MetabolismEnergy metabolismFermentationzinc-binding alcohol dehydrogenase family protein (TIGR02817; HMM-score: 15)
    MetabolismEnergy metabolismAmino acids and aminesadenosylhomocysteinase (TIGR00936; EC 3.3.1.1; HMM-score: 14)
    leukotriene B4 12-hydroxydehydrogenase/15-oxo-prostaglandin 13-reductase (TIGR02825; EC 1.3.1.48,1.3.1.74; HMM-score: 13)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 12.2)
    3-hydroxybutyrate dehydrogenase (TIGR01963; HMM-score: 12.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminglutamyl-tRNA reductase (TIGR01035; EC 1.2.1.70; HMM-score: 10.5)
  • TheSEED:  
    CarbohydratesMonosaccharidesD-Tagatose and Galactitol Utilization Galactitol-1-phosphate 5-dehydrogenase (EC 1.1.1.251) 
  • PFAM:
    GroES (CL0296) ADH_N; Alcohol dehydrogenase GroES-like domain (PF08240; HMM-score: 119.8)
    NADP_Rossmann (CL0063) ADH_zinc_N; Zinc-binding dehydrogenase (PF00107; HMM-score: 92.9)
    Glu_dehyd_C; Glucose dehydrogenase C-terminus (PF16912; HMM-score: 57.5)
    ADH_zinc_N_2; Zinc-binding dehydrogenase (PF13602; HMM-score: 28.1)
    NAD_binding_3; Homoserine dehydrogenase, NAD binding domain (PF03447; HMM-score: 18.6)
    AdoHcyase_NAD; S-adenosyl-L-homocysteine hydrolase, NAD binding domain (PF00670; HMM-score: 17.8)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 16.4)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 13)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 12.4)
    adh_short_C2; Enoyl-(Acyl carrier protein) reductase (PF13561; HMM-score: 12.2)
    Cache (CL0165) CHASE4; CHASE4 domain (PF05228; HMM-score: 12.2)
    GroES (CL0296) ADH_N_2; N-terminal domain of oxidoreductase (PF16884; HMM-score: 12.1)
    NADP_Rossmann (CL0063) 2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 11.4)
    Hybrid (CL0105) HlyD; HlyD membrane-fusion protein of T1SS (PF00529; HMM-score: 11.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Zn2+
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.107
    • Ymax_pos: 11
    • Cmax: 0.104
    • Cmax_pos: 22
    • Smax: 0.129
    • Smax_pos: 1
    • Smean: 0.108
    • D: 0.107
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKALVKTREGHGNLELLDKEVATPLDDKVKIKVHYAGICGTDIHTYEGHYKVNFPVTLGHEFSGEIVEVGADVKDFKVGDRVTSETTFYVCNECEYCKSKDYNLCNHRKGIGTQVDGAFTNYVIAREESLHHIPDEVSYQSAAMTEPLACAHHGVSKIQVNSGDVAVVMGPGPIGLLVAQVLKSKGATVVVTGLDNDKVRLDKAEALHMDYVVNLQQTDLKTYINGITDGYGADVVVECSGAVPAARQGLDILRKKGFYSQIGIFKDAEIPFDMEKVIQKEITVVGSRSQKPADWEPSLQLMADGLVNAEALVTKIYDISKWDEAYQHLKSGEGIKALLKPLDLDENEGEN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]