From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00336
  • pan locus tag?: SAUPAN001898000
  • symbol: SAOUHSC_00336
  • pan gene symbol?:
  • synonym:
  • product: acetyl-CoA acyltransferase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00336
  • symbol: SAOUHSC_00336
  • product: acetyl-CoA acyltransferase
  • replicon: chromosome
  • strand: +
  • coordinates: 347866..349047
  • length: 1182
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    ATGACGAGAGTCGTATTAGCAGCAGCATACAGGACACCTATTGGCGTTTTTGGAGGTGCG
    TTTAAAGACGTGCCAGCCTATGATTTAGGTGCGACTTTAATAGAACATATTATTAAAGAG
    ACGGGTTTGAATCCAAGTGAGATTGATGAAGTTATCATCGGTAACGTACTACAAGCAGGA
    CAAGGACAAAATCCAGCACGAATTGCTGCTATGAAAGGTGGCTTGCCAGAAACAGTACCT
    GCATTTACGGTGAATAAAGTATGTGGTTCTGGGTTAAAGTCGATTCAATTAGCATATCAA
    TCTATTGTGACTGGTGAAAATGACATCGTGCTAGCTGGCGGTATGGAGAATATGTCTCAA
    TCACCAATGCTTGTCAACAACAGTCGCTTTGGTTTTAAAATGGGACATCAATCAATGGTT
    GATAGCATGGTATATGATGGTTTAACAGATGTATTTAATCAATATCATATGGGTATTACT
    GCTGAAAATTTAGTAGAGCAATATGGTATTTCAAGAGAAGAACAAGATACATTTGCTGTA
    AACTCACAACAAAAAGCAGTACGTGCACAGCAAAATGGTGAATTTGATAGTGAAATAGTT
    CCAGTATCGATTCCTCAACGTAAAGGTGAACCAATCGTAGTCACTAAGGATGAAGGTGTA
    CGTGAAAATGTATCAGTCGAAAAATTAAGTCGATTAAGACCAGCTTTCAAAAAAGACGGT
    ACAGTTACAGCAGGTAATGCATCAGGAATCAATGATGGTGCTGCGATGATGTTAGTCATG
    TCAGAAGACAAAGCTAAAGAATTAAATATCGAACCATTGGCAGTGCTTGATGGCTTTGGA
    AGTCATGGTGTAGATCCTTCTATTATGGGTATTGCACCAGTTGGCGCTGTAGAAAAGGCT
    TTGAAACGTAGTAAAAAAGAATTAAGCGATATTGATGTATTTGAATTAAATGAAGCATTT
    GCAGCACAATCATTAGCTGTTGATCGTGAATTAAAATTACCTCCTGAAAAGGTGAATGTT
    AAAGGTGGCGCTATTGCATTAGGACATCCTATTGGTGCATCTGGTGCTAGAGTATTAGTG
    ACATTATTGCATCAACTGAATGATGAAGTTGAAACTGGTTTAACATCATTGTGTATTGGT
    GGCGGTCAAGCTATCGCTGCAGTTGTATCAAAGTATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1182

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_00336
  • symbol: SAOUHSC_00336
  • description: acetyl-CoA acyltransferase
  • length: 393
  • theoretical pI: 4.94056
  • theoretical MW: 41703.4
  • GRAVY: -0.0389313

Function[edit source | edit]

  • reaction:
    EC 2.3.1.9?  ExPASy
    Acetyl-CoA C-acetyltransferase2 acetyl-CoA = CoA + acetoacetyl-CoA
  • TIGRFAM:
    MetabolismFatty acid and phospholipid metabolismOtheracetyl-CoA C-acyltransferase (TIGR01930; EC 2.3.1.16; HMM-score: 501.1)
    3-oxoadipyl-CoA thiolase (TIGR02430; EC 2.3.1.174; HMM-score: 391.9)
    MetabolismFatty acid and phospholipid metabolismDegradationacetyl-CoA C-acyltransferase FadA (TIGR02445; EC 2.3.1.16; HMM-score: 333.6)
    MetabolismFatty acid and phospholipid metabolismDegradationacetyl-CoA C-acyltransferase FadI (TIGR02446; EC 2.3.1.16; HMM-score: 190.9)
    MetabolismFatty acid and phospholipid metabolismBiosynthesisbeta-ketoacyl-acyl-carrier-protein synthase II (TIGR03150; EC 2.3.1.179; HMM-score: 27.2)
    MetabolismFatty acid and phospholipid metabolismBiosynthesis3-oxoacyl-[acyl-carrier-protein] synthase III (TIGR00747; EC 2.3.1.180; HMM-score: 16.8)
  • TheSEED:  
    Amino Acids and DerivativesBranched-chain amino acidsIsoleucine degradation 3-ketoacyl-CoA thiolase (EC 2.3.1.16) 
    CarbohydratesFermentationAcetyl-CoA fermentation to Butyrate Acetyl-CoA acetyltransferase (EC 2.3.1.9) 
    FermentationButanol Biosynthesis Acetyl-CoA acetyltransferase (EC 2.3.1.9) 
    One-carbon MetabolismSerine-glyoxylate cycle 3-ketoacyl-CoA thiolase (EC 2.3.1.16) 
    One-carbon MetabolismSerine-glyoxylate cycle Acetyl-CoA acetyltransferase (EC 2.3.1.9) 
    Cofactors, Vitamins, Prosthetic Groups, PigmentsBiotinBiotin biosynthesis 3-ketoacyl-CoA thiolase (EC 2.3.1.16) 
    Fatty Acids, Lipids, and IsoprenoidsFatty Acids, Lipids, and Isoprenoids - no subcategoryPolyhydroxybutyrate metabolism 3-ketoacyl-CoA thiolase (EC 2.3.1.16) 
    Fatty Acids, Lipids, and Isoprenoids - no subcategoryPolyhydroxybutyrate metabolism Acetyl-CoA acetyltransferase (EC 2.3.1.9) 
    IsoprenoidsArchaeal lipids Acetyl-CoA acetyltransferase (EC 2.3.1.9) 
    IsoprenoidsIsoprenoid Biosynthesis Acetyl-CoA acetyltransferase (EC 2.3.1.9) 
    Butyrate metabolism cluster 3-ketoacyl-CoA thiolase (EC 2.3.1.16) 
  • PFAM:
    Thiolase (CL0046) Thiolase_N; Thiolase, N-terminal domain (PF00108; HMM-score: 363.3)
    Thiolase_C; Thiolase, C-terminal domain (PF02803; HMM-score: 151.2)
    ketoacyl-synt; Beta-ketoacyl synthase, N-terminal domain (PF00109; HMM-score: 28.3)
    FAE1_CUT1_RppA; FAE1/Type III polyketide synthase-like protein (PF08392; HMM-score: 12)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.182
    • Ymax_pos: 23
    • Cmax: 0.144
    • Cmax_pos: 23
    • Smax: 0.346
    • Smax_pos: 1
    • Smean: 0.233
    • D: 0.202
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTRVVLAAAYRTPIGVFGGAFKDVPAYDLGATLIEHIIKETGLNPSEIDEVIIGNVLQAGQGQNPARIAAMKGGLPETVPAFTVNKVCGSGLKSIQLAYQSIVTGENDIVLAGGMENMSQSPMLVNNSRFGFKMGHQSMVDSMVYDGLTDVFNQYHMGITAENLVEQYGISREEQDTFAVNSQQKAVRAQQNGEFDSEIVPVSIPQRKGEPIVVTKDEGVRENVSVEKLSRLRPAFKKDGTVTAGNASGINDGAAMMLVMSEDKAKELNIEPLAVLDGFGSHGVDPSIMGIAPVGAVEKALKRSKKELSDIDVFELNEAFAAQSLAVDRELKLPPEKVNVKGGAIALGHPIGASGARVLVTLLHQLNDEVETGLTSLCIGGGQAIAAVVSKYK

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SAOUHSC_00336 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Roy R Chaudhuri, Andrew G Allen, Paul J Owen, Gil Shalom, Karl Stone, Marcus Harrison, Timothy A Burgis, Michael Lockyer, Jorge Garcia-Lara, Simon J Foster, Stephen J Pleasance, Sarah E Peters, Duncan J Maskell, Ian G Charles
    Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH).
    BMC Genomics: 2009, 10;291
    [PubMed:19570206] [WorldCat.org] [DOI] (I e)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-3661
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]