From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01778
  • pan locus tag?: SAUPAN004290000
  • symbol: clpX
  • pan gene symbol?: clpX
  • synonym:
  • product: ATP-dependent protease ATP-binding subunit ClpX

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_01778
  • symbol: clpX
  • product: ATP-dependent protease ATP-binding subunit ClpX
  • replicon: chromosome
  • strand: -
  • coordinates: 1677874..1679136
  • length: 1263
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGTTTAAATTCAATGAAGATGAAGAAAATTTGAAATGCTCTTTCTGCGGAAAAGACCAA
    GATCAAGTAAAAAAACTTGTAGCAGGAAGTGGTGTATATATTTGTAATGAGTGTATTGAA
    TTATGCTCAGAAATCGTCGAAGAAGAATTAGCTCAAAACACTTCTGAAGCGATGACAGAA
    TTACCTACTCCTAAAGAAATTATGGATCATTTAAACGAATATGTTATTGGTCAAGAAAAA
    GCTAAAAAATCTTTAGCTGTAGCTGTTTATAACCACTATAAGCGTATTCAACAATTAGGA
    CCAAAAGAAGATGATGTTGAATTACAAAAAAGTAACATTGCATTAATTGGGCCAACAGGT
    AGTGGTAAAACATTATTAGCTCAAACCTTAGCCAAGACGTTGAATGTACCATTTGCAATT
    GCAGATGCGACAAGTTTAACTGAAGCTGGTTATGTAGGCGATGATGTTGAAAATATCTTG
    TTGAGATTAATTCAAGCAGCTGACTTTGACATTGATAAAGCCGAAAAAGGTATTATTTAT
    GTAGATGAAATTGATAAAATTGCACGTAAATCTGAAAACACATCTATAACACGTGACGTT
    TCAGGTGAAGGTGTTCAACAAGCATTGCTTAAAATCTTAGAAGGTACGACTGCAAGTGTT
    CCGCCACAAGGTGGACGCAAACATCCAAACCAAGAAATGATTCAAATTGATACAACAAAT
    ATCTTATTTATTCTTGGTGGTGCCTTTGATGGTATTGAAGAAGTGATTAAGCGCCGTCTT
    GGTGAAAAAGTTATTGGTTTCTCAAGCAATGAAGCTGATAAATATGACGAACAAGCATTA
    TTAGCACAAATTCGCCCAGAAGATTTGCAAGCCTATGGTTTGATTCCTGAATTTATCGGA
    CGTGTGCCAATTGTAGCTAATTTAGAAACATTAGATGTAACTGCGTTGAAAAACATCTTA
    ACGCAACCTAAAAATGCACTTGTGAAACAATATACTAAAATGCTGGAATTAGATGATGTG
    GATTTAGAGTTCACTGAAGAAGCTTTATCAGCAATTAGTGAAAAAGCAATTGAAAGAAAA
    ACAGGTGCGCGTGGTTTACGTTCAATCATAGAAGAATCGTTAATCGATATTATGTTTGAT
    GTGCCTTCTAACGAAAATGTAACGAAGGTAGTTATTACAGCACAAACAATTAATGAAGAA
    ACTGAACCAGAACTATACGACGCAGAAGGCAATTTAATTAATAATAGTAAAACATCAGCT
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1263

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_01778
  • symbol: ClpX
  • description: ATP-dependent protease ATP-binding subunit ClpX
  • length: 420
  • theoretical pI: 4.26448
  • theoretical MW: 46297.2
  • GRAVY: -0.265238

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 660.9)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 660.9)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent protease HslVU, ATPase subunit (TIGR00390; HMM-score: 212.6)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease ATP-binding subunit ClpA (TIGR02639; HMM-score: 46.1)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent chaperone protein ClpB (TIGR03346; HMM-score: 36.9)
    Cellular processesCellular processesPathogenesistype VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 36.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 36.2)
    AAA family ATPase, CDC48 subfamily (TIGR01243; HMM-score: 31.4)
    26S proteasome subunit P45 family (TIGR01242; HMM-score: 30)
    Cellular processesCellular processesCell divisionATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 27.4)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 27.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 25.4)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesendopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 23.8)
    Cellular processesCellular processesChemotaxis and motilityflagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 23.2)
    Unknown functionGeneralMg chelatase-like protein (TIGR00368; HMM-score: 22.2)
    nicotinamide-nucleotide adenylyltransferase (TIGR01526; EC 2.7.7.1; HMM-score: 21.3)
    Cellular processesCellular processesOthergas vesicle protein GvpN (TIGR02640; HMM-score: 20.1)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesputative ATP-dependent protease (TIGR00764; HMM-score: 16.9)
    Hypothetical proteinsConservedTIGR00270 family protein (TIGR00270; HMM-score: 16.5)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairorc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 15.8)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionscytidylate kinase (TIGR00017; EC 2.7.4.14; HMM-score: 14.5)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 13.1)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA dimethylallyltransferase (TIGR00174; EC 2.5.1.75; HMM-score: 12.8)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 12.8)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 12.8)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 12.1)
    carbohydrate kinase, thermoresistant glucokinase family (TIGR01313; EC 2.7.1.-; HMM-score: 12.1)
  • TheSEED:  
    Protein MetabolismProtein degradationProteasome bacterial ATP-dependent Clp protease ATP-binding subunit ClpX 
    Protein degradationProteolysis in bacteria, ATP-dependent ATP-dependent Clp protease ATP-binding subunit ClpX 
  • PFAM:
    P-loop_NTPase (CL0023) AAA_2; AAA domain (Cdc48 subfamily) (PF07724; HMM-score: 165)
    Zn_Beta_Ribbon (CL0167) zf-C4_ClpX; ClpX C4-type zinc finger (PF06689; HMM-score: 67.6)
    no clan definedClpB_D2-small; C-terminal, D2-small domain, of ClpB protein (PF10431; HMM-score: 59.7)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 59.7)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 27.8)
    AAA_22; AAA domain (PF13401; HMM-score: 27.7)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 26)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 22.4)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 18.8)
    AAA_18; AAA domain (PF13238; HMM-score: 18.4)
    MCM; MCM2/3/5 family (PF00493; HMM-score: 18.3)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 17.7)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 17.7)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 17)
    Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 16.8)
    AAA_14; AAA domain (PF13173; HMM-score: 16.7)
    ABC_tran; ABC transporter (PF00005; HMM-score: 16.5)
    NACHT; NACHT domain (PF05729; HMM-score: 15.8)
    AAA_24; AAA domain (PF13479; HMM-score: 15.1)
    AAA_28; AAA domain (PF13521; HMM-score: 14.1)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 14)
    AAA_17; AAA domain (PF13207; HMM-score: 14)
    Cytidylate_kin; Cytidylate kinase (PF02224; HMM-score: 13.8)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 13.8)
    AAA_33; AAA domain (PF13671; HMM-score: 13.5)
    PhoH; PhoH-like protein (PF02562; HMM-score: 13.2)
    PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 12.6)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 12.6)
    C1 (CL0006) C1_2; C1 domain (PF03107; HMM-score: 11.7)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.124
    • Ymax_pos: 52
    • Cmax: 0.119
    • Cmax_pos: 58
    • Smax: 0.273
    • Smax_pos: 27
    • Smean: 0.127
    • D: 0.125
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MFKFNEDEENLKCSFCGKDQDQVKKLVAGSGVYICNECIELCSEIVEEELAQNTSEAMTELPTPKEIMDHLNEYVIGQEKAKKSLAVAVYNHYKRIQQLGPKEDDVELQKSNIALIGPTGSGKTLLAQTLAKTLNVPFAIADATSLTEAGYVGDDVENILLRLIQAADFDIDKAEKGIIYVDEIDKIARKSENTSITRDVSGEGVQQALLKILEGTTASVPPQGGRKHPNQEMIQIDTTNILFILGGAFDGIEEVIKRRLGEKVIGFSSNEADKYDEQALLAQIRPEDLQAYGLIPEFIGRVPIVANLETLDVTALKNILTQPKNALVKQYTKMLELDDVDLEFTEEALSAISEKAIERKTGARGLRSIIEESLIDIMFDVPSNENVTKVVITAQTINEETEPELYDAEGNLINNSKTSA

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  4. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]