From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_1102 [new locus tag: SAUSA300_RS05970 ]
  • pan locus tag?: SAUPAN003491000
  • symbol: gmk
  • pan gene symbol?: gmk
  • synonym:
  • product: guanylate kinase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_1102 [new locus tag: SAUSA300_RS05970 ]
  • symbol: gmk
  • product: guanylate kinase
  • replicon: chromosome
  • strand: +
  • coordinates: 1206797..1207420
  • length: 624
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGGATAATGAAAAAGGATTGTTAATCGTTTTATCAGGACCATCTGGAGTAGGTAAAGGT
    ACTGTTAGAAAACGAATATTTGAAGATCCAAGTACATCATATAAGTATTCTATTTCAATG
    ACAACACGTCAAATGCGTGAAGGTGAAGTTGATGGCGTAGATTACTTTTTTAAAACTAGG
    GATGCGTTTGAAGCTTTAATCAAAGATGACCAATTTATAGAATATGCTGAATATGTAGGC
    AACTATTATGGTACACCAGTTCAATATGTTAAAGATACAATGGACGAAGGTCATGATGTA
    TTTTTAGAAATTGAAGTAGAAGGTGCAAAGCAAGTTAGAAAGAAATTTCCAGATGCGCTA
    TTTATTTTCTTAGCACCTCCAAGTTTAGAACACTTGAGAGAGCGATTAGTAGGTAGAGGA
    ACAGAATCTGATGAGAAAATACAAAGTCGTATTAACGAAGCGCGTAAAGAAGTTGAAATG
    ATGAATTTATACGATTACGTTGTAGTTAATGATGAAGTAGAACTTGCGAAGAATAGAATT
    CAATGTATTGTAGAAGCTGAGCACTTAAAAAGAGAGCGCGTAGAAGCTAAGTATAGAAAA
    ATGATTTTGGAGGCTAAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    624

Protein[edit source | edit]

Protein Data Bank: 2J41

General[edit source | edit]

  • locus tag: SAUSA300_1102 [new locus tag: SAUSA300_RS05970 ]
  • symbol: Gmk
  • description: guanylate kinase
  • length: 207
  • theoretical pI: 5.10267
  • theoretical MW: 24037.2
  • GRAVY: -0.579227

Function[edit source | edit]

  • reaction:
    EC 2.7.4.8?  ExPASy
    Guanylate kinaseATP + GMP = ADP + GDP
  • TIGRFAM:
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsguanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 238.9)
    MetabolismCentral intermediary metabolismPhosphorus compoundsphosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 47.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme Adephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 19)
    putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 14.1)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsadenylate kinase (TIGR01351; EC 2.7.4.-; HMM-score: 13.5)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 12.4)
  • TheSEED:  
    Nucleosides and NucleotidesPurinesPurine conversions Guanylate kinase (EC 2.7.4.8) 
  • PFAM:
    P-loop_NTPase (CL0023) Guanylate_kin; Guanylate kinase (PF00625; HMM-score: 172.1)
    AAA_18; AAA domain (PF13238; HMM-score: 19.7)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 14.3)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 14.3)
    AAA_22; AAA domain (PF13401; HMM-score: 14.1)
    AAA_17; AAA domain (PF13207; HMM-score: 14.1)
    AAA_33; AAA domain (PF13671; HMM-score: 13.8)
    ABC_tran; ABC transporter (PF00005; HMM-score: 13.6)
    no clan definedYtxH; YtxH-like protein (PF12732; HMM-score: 13.2)
    P-loop_NTPase (CL0023) RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 11.9)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.132
    • Ymax_pos: 25
    • Cmax: 0.117
    • Cmax_pos: 36
    • Smax: 0.226
    • Smax_pos: 23
    • Smean: 0.152
    • D: 0.139
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MDNEKGLLIVLSGPSGVGKGTVRKRIFEDPSTSYKYSISMTTRQMREGEVDGVDYFFKTRDAFEALIKDDQFIEYAEYVGNYYGTPVQYVKDTMDEGHDVFLEIEVEGAKQVRKKFPDALFIFLAPPSLEHLRERLVGRGTESDEKIQSRINEARKEVEMMNLYDYVVVNDEVELAKNRIQCIVEAEHLKRERVEAKYRKMILEAKK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]