From AureoWiki
Jump to: navigation, search

NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_1578 [new locus tag: SAUSA300_RS08600 ]
  • pan locus tag?: SAUPAN004221000
  • symbol: mnmA
  • pan gene symbol?: mnmA
  • synonym:
  • product: tRNA-specific 2-thiouridylase MnmA

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_1578 [new locus tag: SAUSA300_RS08600 ]
  • symbol: mnmA
  • product: tRNA-specific 2-thiouridylase MnmA
  • replicon: chromosome
  • strand: -
  • coordinates: 1728638..1729723
  • length: 1086
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGTCAGGCGGTGTAGATAGTTCTGTAACAGCCCACGTCTTAAAAGAACAAGGTTATGAT
    GTCATTGGCATATTTATGAAAAACTGGGATGACACTGACGAAAATGGCGTATGTACTGCA
    ACTGAAGATTACAACGATGTTATTGAAGTGTGTAATCAAATTGGCATTCCGTATTACGCT
    GTTAATTTTGAAAAAGAATATTGGGATAAAGTCTTTACGTATTTCTTAGATGAATACAAA
    AAAGGTCGTACTCCAAATCCAGACGTTATGTGTAATAAAGAAATTAAGTTTAAAGCCTTT
    TTAGATCATGCGATGAATTTAGGTGCAGATTATGTAGCAACAGGACATTACGCACGCATA
    CATCGTCATGAAGATGGTCATGTTGAAATGTTACGTGGTGTAGATAATAATAAAGATCAA
    ACATACTTCTTGAATCAATTATCTCAACAACAACTTTCAAAAGTGATGTTCCCAATTGGC
    GACATCGAAAAGAGTGAAGTGCGTCGAATTGCTGAAGAACAAGGACTTGTTACTGCTAAG
    AAAAAAGATTCTACAGGCATTTGTTTTATCGGCGAAAAAAACTTTAAAACATTTTTATCA
    CAATATTTACCTGCACAACCGGGTGATATGATAACACTTGATGGTAAGAAAATGGGTAAA
    CATAGTGGTTTGATGTATTACACAATAGGACAAAGACATGGATTAGGTATAGGTGGAGAT
    GGCGATCCTTGGTTTGTTGTCGGTAAAAACCTAAAAGATAATGTTTTATATGTAGAACAA
    GGATTCCATCACGATGCATTATACAGTGATTACTTAATTGCTTCAGACTATTCATTTGTA
    AATCCAGAAGATAATGACTTAGATCAAGGTTTTGAATGTACAGCTAAATTTAGATATCGC
    CAAAAAGATACGAAAGTTTTTGTGAAACGTGAAAACGACCATGCACTACGTGTTACTTTT
    GCTGAGCCAGTAAGAGCAATCACACCTGGACAAGCAGTTGTTTTTTATCAAGGTGATGTG
    TGTCTTGGTGGTGCAACAATTGACGATGTGTTCAAAAATGAAGGTCAATTAAATTATGTT
    GTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1086

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_1578 [new locus tag: SAUSA300_RS08600 ]
  • symbol: MnmA
  • description: tRNA-specific 2-thiouridylase MnmA
  • length: 361
  • theoretical pI: 5.04549
  • theoretical MW: 40950.7
  • GRAVY: -0.477839

Function[edit source | edit]

  • reaction:
    EC 2.8.1.13?  ExPASy
    tRNA-uridine 2-sulfurtransferaseA [protein]-S-sulfanyl-L-cysteine + uridine34 in tRNA + ATP + reduced acceptor = a [protein]-L-cysteine + 2-thiouridine34 in tRNA + AMP + diphosphate + acceptor
    EC 2.1.1.61?  ExPASy
    tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferaseS-adenosyl-L-methionine + tRNA containing 5-aminomethyl-2-thiouridine = S-adenosyl-L-homocysteine + tRNA containing 5-methylaminomethyl-2-thiouridylate
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (TIGR00420; EC 2.1.1.61; HMM-score: 445.5)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA(Ile)-lysidine synthetase (TIGR02432; EC 6.3.4.-; HMM-score: 20.7)
    Hypothetical proteinsConservedTIGR00268 family protein (TIGR00268; HMM-score: 16.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridine nucleotidesNAD+ synthetase (TIGR00552; EC 6.3.1.5; HMM-score: 14.3)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA sulfurtransferase ThiI (TIGR00342; EC 2.8.1.4; HMM-score: 13.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminetRNA sulfurtransferase ThiI (TIGR00342; EC 2.8.1.4; HMM-score: 13.3)
    Unknown functionGeneralqueuosine biosynthesis protein QueC (TIGR00364; HMM-score: 12.9)
    Plasmodium falciparum CPW-WPC domain (TIGR01492; HMM-score: 12)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisGMP synthase (glutamine-hydrolyzing), C-terminal domain (TIGR00884; EC 6.3.5.2; HMM-score: 11.4)
  • TheSEED:  
    At5g37530 (CsdL protein family) tRNA-specific 2-thiouridylase MnmA (EC 2.8.1.13) 
  • PFAM:
    HUP (CL0039) tRNA_Me_trans; tRNA methyl transferase (PF03054; HMM-score: 483)
    QueC; Queuosine biosynthesis protein QueC (PF06508; HMM-score: 16.1)
    NAD_synthase; NAD synthase (PF02540; HMM-score: 14)
    ATP_bind_3; PP-loop family (PF01171; HMM-score: 13.8)
    Asn_synthase; Asparagine synthase (PF00733; HMM-score: 12.8)
    ThiI; Thiamine biosynthesis protein (ThiI) (PF02568; HMM-score: 12.8)
    TIKI (CL0572) Cofac_haem_bdg; Haem-binding uptake, Tiki superfamily, ChaN (PF04187; HMM-score: 12.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SAUSA300_2187(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.105
    • Ymax_pos: 40
    • Cmax: 0.127
    • Cmax_pos: 19
    • Smax: 0.139
    • Smax_pos: 36
    • Smean: 0.087
    • D: 0.098
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSGGVDSSVTAHVLKEQGYDVIGIFMKNWDDTDENGVCTATEDYNDVIEVCNQIGIPYYAVNFEKEYWDKVFTYFLDEYKKGRTPNPDVMCNKEIKFKAFLDHAMNLGADYVATGHYARIHRHEDGHVEMLRGVDNNKDQTYFLNQLSQQQLSKVMFPIGDIEKSEVRRIAEEQGLVTAKKKDSTGICFIGEKNFKTFLSQYLPAQPGDMITLDGKKMGKHSGLMYYTIGQRHGLGIGGDGDPWFVVGKNLKDNVLYVEQGFHHDALYSDYLIASDYSFVNPEDNDLDQGFECTAKFRYRQKDTKVFVKRENDHALRVTFAEPVRAITPGQAVVFYQGDVCLGGATIDDVFKNEGQLNYVV

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]