From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS10490 [old locus tag: SAUSA300_1916 ]
  • pan locus tag?: SAUPAN005004000
  • symbol: SAUSA300_RS10490
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_RS10490 [old locus tag: SAUSA300_1916 ]
  • symbol: SAUSA300_RS10490
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2080435..2081721
  • length: 1287
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_007793 (2080435..2081721) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGAATCCTTTAGCCCAAAGCTTAAATGAACAACTTCAACAGTCAAATGCAACTGCCTTT
    ACAATGTTATCTGACTTAGGTCAAAATATGTTTTATCCAAAAGGCATTTTATCTCAATCT
    GCTGAAGCAAAGAGTACAACATATAATGCAACTATAGGTATGGCGACAAACAAAGACGGA
    AAAATGTTTGCATCATCTTTAGATGCAATGTTTAATGATTTAACTCCAGATGAAATATTC
    CCTTATGCGCCACCACAAGGCATCGAAGAATTACGTGATTTATGGCAACAAAAAATGTTG
    CGTGACAATCCAGAGCTATCAATCGACAACATGTCACTACCAATTGTTACGAATGCATTA
    ACACATGGTTTATCTTTAGTTGGCGATTTATTTGTAAATCAAGGTGACACTATCTTGTTA
    CCAGAGCATAATTGGGGTAATTACAAACTTGTTTTCAATACGAGAAATGGTGCAAACCTT
    CAAACATATCCTATCTTTGATAAAGACGGGCATTATACTACTGATTCACTTGTAGAAGCT
    TTACAATCATACAATAAAGATAAAGTCATTATGATTTTAAATTATCCTAATAATCCGACA
    GGTTACACACCTACGCATAAAGAAGTGACTACCATCGTCGATGCAATTAAAGCATTAGCT
    GATAAAGGTACAAAAGTTATAGCTGTTGTGGATGACGCATACTATGGTTTATTCTATGAA
    GATGTGTATACTCAATCATTATTTACTGCATTATCTAATTTAAATTCAAATGCAATATTA
    CCTGTTCGTTTAGATGGTGCAACAAAAGAATTTTTCGCATGGGGATTCCGTGTTGGGTTT
    ATGACATTTGGAACGTCTGATCAAACAACTAAAGAAGTATTAGAAGCCAAAGTAAAAGGT
    CTTATACGAAGTAACATTTCTAGTGGACCTCTTCCAACACAAAGCGCTGTTAAGCATGTA
    TTAAAAAATAATAAACAATTCGATAAAGAAATCGAACAAAATATTCAAACATTAAAAGAA
    CGCTATGAAGTCACTAAGGAAGTTGTCTATGCTGATCAATATCATTCACATTGGCAAGCC
    TATGACTTTAACTCTGGATACTTTATGGCAATAAAAGTTCATGATGTTGACCCTGAAGAA
    CTTCGTAAACATTTAATTGAAAAATATTCAATTGGTGTTATTGCACTTAATGCAACAGAT
    ATTCGTATTGCGTTTAGCTGTGTAGAAAAAGAAGATATCCCACATGTATTTGATTCAATT
    GCTAAAGCGATTGATGACTTAAGATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1287

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_RS10490 [old locus tag: SAUSA300_1916 ]
  • symbol: SAUSA300_RS10490
  • description: hypothetical protein
  • length: 428
  • theoretical pI: 4.88204
  • theoretical MW: 48119
  • GRAVY: -0.316355

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    tyrosine/nicotianamine family aminotransferase (TIGR01265; HMM-score: 64.4)
    MetabolismEnergy metabolismAmino acids and aminestyrosine aminotransferase (TIGR01264; EC 2.6.1.5; HMM-score: 62.8)
    LL-diaminopimelate aminotransferase (TIGR03540; EC 2.6.1.83; HMM-score: 56.3)
    MetabolismAmino acid biosynthesisHistidine familyhistidinol-phosphate transaminase (TIGR01141; EC 2.6.1.9; HMM-score: 43.3)
    putative C-S lyase (TIGR04350; EC 4.4.-.-; HMM-score: 35.3)
    beta-methylarginine biosynthesis bifunctional aminotransferase (TIGR04544; EC 2.6.-.-; HMM-score: 32.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminthreonine-phosphate decarboxylase (TIGR01140; EC 4.1.1.81; HMM-score: 26.2)
    Cellular processesCellular processesBiosynthesis of natural productscapreomycidine synthase (TIGR03947; HMM-score: 25.8)
    succinyldiaminopimelate transaminase (TIGR03539; EC 2.6.1.17; HMM-score: 24.8)
    LL-diaminopimelate aminotransferase (TIGR03542; EC 2.6.1.83; HMM-score: 19.9)
    succinyldiaminopimelate transaminase (TIGR03537; EC 2.6.1.17; HMM-score: 13.5)
    [FeFe] hydrogenase, group B1/B3 (TIGR04105; EC 1.12.-.-; HMM-score: 10.5)
  • TheSEED:
  • PFAM:
    PLP_aminotran (CL0061) Aminotran_1_2; Aminotransferase class I and II (PF00155; HMM-score: 125.1)
    Thioredoxin (CL0172) AhpC-TSA; AhpC/TSA family (PF00578; HMM-score: 16)
    no clan definedSpore_II_R; Stage II sporulation protein R (spore_II_R) (PF09551; HMM-score: 14.2)
    4HB_MCP (CL0457) 4HB_MCP_1; Four helix bundle sensory module for signal transduction (PF12729; HMM-score: 13.6)
    no clan definedNEMO; NF-kappa-B essential modulator NEMO (PF11577; HMM-score: 10.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.223
    • Ymax_pos: 20
    • Cmax: 0.2
    • Cmax_pos: 20
    • Smax: 0.336
    • Smax_pos: 12
    • Smean: 0.231
    • D: 0.226
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446991286 NCBI
  • RefSeq: WP_001068542 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNPLAQSLNEQLQQSNATAFTMLSDLGQNMFYPKGILSQSAEAKSTTYNATIGMATNKDGKMFASSLDAMFNDLTPDEIFPYAPPQGIEELRDLWQQKMLRDNPELSIDNMSLPIVTNALTHGLSLVGDLFVNQGDTILLPEHNWGNYKLVFNTRNGANLQTYPIFDKDGHYTTDSLVEALQSYNKDKVIMILNYPNNPTGYTPTHKEVTTIVDAIKALADKGTKVIAVVDDAYYGLFYEDVYTQSLFTALSNLNSNAILPVRLDGATKEFFAWGFRVGFMTFGTSDQTTKEVLEAKVKGLIRSNISSGPLPTQSAVKHVLKNNKQFDKEIEQNIQTLKERYEVTKEVVYADQYHSHWQAYDFNSGYFMAIKVHDVDPEELRKHLIEKYSIGVIALNATDIRIAFSCVEKEDIPHVFDSIAKAIDDLR

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SAUSA300_RS10490 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]