From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS00165 [old locus tag: SA0005 ]
  • pan locus tag?: SAUPAN000011000
  • symbol: SA_RS00165
  • pan gene symbol?: gyrB
  • synonym:
  • product: DNA gyrase subunit B

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS00165 [old locus tag: SA0005 ]
  • symbol: SA_RS00165
  • product: DNA gyrase subunit B
  • replicon: chromosome
  • strand: +
  • coordinates: 5034..6968
  • length: 1935
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (5034..6968) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    ATGGTGACTGCATTGTCAGATGTAAACAACACGGATAATTATGGTGCTGGGCAAATACAA
    GTATTAGAAGGTTTAGAAGCAGTACGTAAAAGACCAGGTATGTATATAGGATCGACTTCA
    GAGAGAGGTTTGCACCATTTAGTGTGGGAAATTGTCGATAATAGTATCGATGAAGCATTA
    GCTGGTTATGCAAATAAAATTGAAGTTGTTATTGAAAAAGATAACTGGATTAAAGTAACG
    GATAACGGACGTGGTATCCCAGTTGATATTCAAGAAAAAATGGGACGTCCAGCTGTCGAA
    GTTATTTTAACTGTTTTACATGCTGGTGGTAAATTCGGCGGTGGCGGATACAAAGTATCT
    GGTGGTTTACATGGTGTTGGTTCATCAGTTGTAAACGCATTGTCACAAGACTTAGAAGTA
    TATGTACACAGAAATGAGACTATATATCATCAAGCATATAAAAAAGGTGTACCTCAATTT
    GACTTAAAAGAAGTTGGCACAACTGATAAGACAGGTACTGTCATTCGTTTTAAAGCAGAT
    GGAGAAATCTTCACAGAGACAACTGTATACAACTATGAAACATTACAGCAGCGTATTAGA
    GAGCTTGCTTTCTTAAACAAAGGAATTCAAATCACATTAAGAGATGAACGTGATGAAGAA
    AACGTTAGAGAAGACTCCTATCACTATGAGGGCGGTATTAAATCGTACGTTGAGTTATTG
    AACGAAAATAAAGAACCTATTCATGATGAGCCAATTTATATTCATCAATCTAAAGATGAT
    ATTGAAGTAGAAATTGCGATTCAATATAACTCAGGATATGCCACAAATCTTTTAACTTAC
    GCAAATAACATTCATACGTATGAAGGTGGTACGCATGAAGACGGATTCAAACGTGCATTA
    ACGCGTGTCTTAAATAGTTATGGTTTAAGTAGCAAGATTATGAAAGAAGAAAAAGATAGA
    CTTTCTGGTGAAGATACACGTGAAGGTATGACAGCAATTATATCTATCAAACATGGTGAT
    CCTCAATTCGAAGGTCAAACGAAGACAAAATTAGGTAATTCTGAAGTGCGTCAAGTTGTA
    GATAAATTATTCTCAGAGCACTTTGAACGATTTTTATATGAAAATCCACAAGTCGCACGT
    ACAGTGGTTGAAAAAGGTATTATGGCGGCACGTGCACGTGTTGCTGCGAAAAAAGCGCGT
    GAAGTAACACGTCGTAAATCAGCGTTAGATGTAGCAAGTCTTCCAGGTAAATTAGCCGAT
    TGCTCTAGTAAAAGTCCTGAAGAATGTGAGATTTTCTTAGTCGAAGGGGACTCTGCCGGG
    GGGTCTACAAAATCTGGTCGTGACTCTAGAACGCAGGCGATTTTACCATTACGAGGTAAG
    ATATTAAATGTTGAAAAAGCACGATTAGATAGAATTTTGAATAACAATGAAATTCGTCAA
    ATGATCACAGCATTTGGTACAGGAATCGGTGGCGACTTTGATCTAGCGAAAGCAAGATAT
    CACAAAATCGTCATTATGACTGATGCCGATGTGGATGGAGCGCATATTAGAACATTGTTA
    TTAACATTCTTCTATCGATTTATGAGACCGTTAATTGAAGCAGGCTATGTGTATATTGCA
    CAGCCACCGTTGTATAAACTGACACAAGGTAAACAAAAGTATTATGTATACAATGATAGG
    GAACTTGATAAACTTAAATCTGAATTGAATCCAACACCAAAATGGTCTATTGCACGATAC
    AAAGGTCTTGGAGAAATGAATGCAGATCAATTATGGGAAACAACAATGAACCCTGAGCAC
    CGCGCTCTTTTACAAGTAAAACTTGAAGATGCGATTGAAGCGGACCAAACATTTGAAATG
    TTAATGGGTGACGTTGTAGAAAACCGTAGACAATTTATAGAAGATAATGCAGTTTATGCA
    AACTTAGACTTCTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1935

Protein[edit source | edit]

Protein Data Bank: 2XCO
Protein Data Bank: 2XCQ
Protein Data Bank: 2XCR
Protein Data Bank: 2XCS
Protein Data Bank: 2XCT
Protein Data Bank: 4BUL
Protein Data Bank: 5CDM
Protein Data Bank: 5CDN
Protein Data Bank: 5CDO
Protein Data Bank: 5CDP
Protein Data Bank: 5CDQ
Protein Data Bank: 5CDR
Protein Data Bank: 5NPK
Protein Data Bank: 5NPP

General[edit source | edit]

  • locus tag: SA_RS00165 [old locus tag: SA0005 ]
  • symbol: SA_RS00165
  • description: DNA gyrase subunit B
  • length: 644
  • theoretical pI: 5.79427
  • theoretical MW: 72539.4
  • GRAVY: -0.490528

Function[edit source | edit]

  • reaction:
    EC 5.99.1.3?  ExPASy
    DNA topoisomerase (ATP-hydrolyzing)ATP-dependent breakage, passage and rejoining of double-stranded DNA
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA gyrase, B subunit (TIGR01059; EC 5.99.1.3; HMM-score: 993.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA topoisomerase IV, B subunit (TIGR01058; EC 5.99.1.-; HMM-score: 828)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA topoisomerase IV, B subunit (TIGR01055; EC 5.99.1.-; HMM-score: 606.5)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA mismatch repair protein MutL (TIGR00585; HMM-score: 20.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA topoisomerase VI, B subunit (TIGR01052; EC 5.99.1.3; HMM-score: 16.1)
  • TheSEED:
  • PFAM:
    S5 (CL0329) DNA_gyraseB; DNA gyrase B (PF00204; HMM-score: 211.7)
    no clan definedDNA_gyraseB_C; DNA gyrase B subunit, carboxyl terminus (PF00986; HMM-score: 103.4)
    His_Kinase_A (CL0025) HATPase_c; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (PF02518; HMM-score: 77.6)
    Toprim-like (CL0413) Toprim; Toprim domain (PF01751; HMM-score: 63)
    His_Kinase_A (CL0025) HATPase_c_3; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (PF13589; HMM-score: 20.8)
    no clan definedTOPRIM_C; C-terminal associated domain of TOPRIM (PF16898; HMM-score: 16.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Ca2+, Mg2+, Mn2+
  • effectors:
  • protein partners:
    SA_RS00170DNA gyrase subunit A  [1] (data from MRSA252)
    SA_RS02955elongation factor G  [1] (data from MRSA252)
    SA_RS06295translation initiation factor IF-2  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.096
    • Ymax_pos: 25
    • Cmax: 0.124
    • Cmax_pos: 16
    • Smax: 0.107
    • Smax_pos: 29
    • Smean: 0.076
    • D: 0.088
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446177723 NCBI
  • RefSeq: WP_000255578 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MVTALSDVNNTDNYGAGQIQVLEGLEAVRKRPGMYIGSTSERGLHHLVWEIVDNSIDEALAGYANKIEVVIEKDNWIKVTDNGRGIPVDIQEKMGRPAVEVILTVLHAGGKFGGGGYKVSGGLHGVGSSVVNALSQDLEVYVHRNETIYHQAYKKGVPQFDLKEVGTTDKTGTVIRFKADGEIFTETTVYNYETLQQRIRELAFLNKGIQITLRDERDEENVREDSYHYEGGIKSYVELLNENKEPIHDEPIYIHQSKDDIEVEIAIQYNSGYATNLLTYANNIHTYEGGTHEDGFKRALTRVLNSYGLSSKIMKEEKDRLSGEDTREGMTAIISIKHGDPQFEGQTKTKLGNSEVRQVVDKLFSEHFERFLYENPQVARTVVEKGIMAARARVAAKKAREVTRRKSALDVASLPGKLADCSSKSPEECEIFLVEGDSAGGSTKSGRDSRTQAILPLRGKILNVEKARLDRILNNNEIRQMITAFGTGIGGDFDLAKARYHKIVIMTDADVDGAHIRTLLLTFFYRFMRPLIEAGYVYIAQPPLYKLTQGKQKYYVYNDRELDKLKSELNPTPKWSIARYKGLGEMNADQLWETTMNPEHRALLQVKLEDAIEADQTFEMLMGDVVENRRQFIEDNAVYANLDF

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS00165 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]