From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS06295 [old locus tag: SA1112 ]
  • pan locus tag?: SAUPAN003570000
  • symbol: SA_RS06295
  • pan gene symbol?: infB
  • synonym:
  • product: translation initiation factor IF-2

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS06295 [old locus tag: SA1112 ]
  • symbol: SA_RS06295
  • product: translation initiation factor IF-2
  • replicon: chromosome
  • strand: +
  • coordinates: 1260765..1262882
  • length: 2118
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (1260765..1262882) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    ATGAGTAAACAAAGAATTTACGAATATGCGAAAGAATTAAATCTAAAGAGTAAAGAGATT
    ATAGATGAGTTAAAAAGCATGAATATAGAGGTTTCAAATCATATGCAAGCTTTGGAAGAT
    GACCAAATTAAAGCATTAGATAAAAAGTTCAAAAAAGAACAAAAGAACGACAATAAACAA
    AGCACTCAAAATAATCACCAAAAATCAAACAATCAAAACCAAAATAAAGGGCAACAAAAA
    GATAACAAAAAGAATCAACAACAAAATAATAAAGGCAACAAAGGCAATAAAAAGAATAAT
    AGAAATAATAAGAAAAATAACAAGAATAATAAACCACAAAATCAACCAGCTGCTCCAAAA
    GAAATACCATCAAAAGTGACATATCAAGAAGGTATTACAGTAGGCGAATTTGCGGATAAA
    TTAAATGTTGAATCATCAGAAATTATCAAAAAATTATTCTTACTTGGTATTGTTGCTAAT
    ATCAATCAATCATTAAATCAAGAAACAATCGAATTAATTGCCGATGATTATGGCGTTGAG
    GTTGAAGAAGAAGTTGTGATTAATGAAGAAGATTTATCAATCTACTTCGAAGACGAAAAA
    GATGATCCAGAAGCAATTGAGAGACCAGCAGTTGTAACAATTATGGGACATGTTGACCAT
    GGTAAAACGACTTTATTAGATTCAATTCGTCATACAAAAGTTACAGCAGGTGAAGCAGGC
    GGAATCACTCAACATATTGGTGCATATCAAATTGAAAACGATGGCAAAAAAATCACTTTC
    TTAGATACACCGGGACATGCTGCATTTACAACGATGCGTGCGCGTGGTGCACAAGTAACA
    GATATTACAATTTTAGTAGTAGCAGCTGACGATGGTGTTATGCCACAAACAATTGAAGCA
    ATTAACCATGCTAAAGAAGCAGAAGTACCAATTATTGTTGCAGTAAATAAAATTGATAAA
    CCAACTTCAAATCCTGATCGAGTTATGCAAGAATTAACTGAATATGGTTTAATTCCTGAA
    GATTGGGGCGGCGAAACAATTTTCGTTCCACTTTCTGCATTAAGTGGTGATGGTATCGAC
    GATTTATTAGAAATGATAGGATTAGTTGCAGAAGTTCAAGAACTTAAAGCAAATCCTAAA
    AACCGTGCTGTTGGTACAGTTATCGAAGCTGAATTAGATAAATCACGTGGTCCTTCTGCA
    TCATTATTAGTACAAAACGGTACATTAAATGTTGGTGATGCGATTGTAGTTGGTAATACT
    TACGGCCGTATCCGTGCAATGGTTAATGACTTAGGTCAAAGAATCAAAACGGCTGGTCCA
    TCAACGCCTGTTGAAATTACAGGTATTAATGATGTGCCACAAGCTGGGGATCGCTTTGTT
    GTATTTAGTGATGAAAAACAAGCTCGTCGTATTGGTGAATCAAGACACGAAGCTAGCATT
    GTACAACAACGTCAAGAAAGTAAAAATGTTTCATTAGATAACCTGTTTGAACAAATGAAA
    CAAGGTGAAATGAAAGATTTAAACGTTATTATTAAAGGTGATGTTCAAGGTTCTGTTGAA
    GCTTTAGCTGCATCATTAATGAAAATTGATGTTGAAGGCGTAAATGTTCGTATCATTCAT
    ACAGCGGTTGGTGCAATTAATGAGTCAGACGTGACACTTGCTAATGCCTCAAATGGTATT
    ATCATTGGTTTCAATGTTCGTCCAGACAGTGGTGCAAAACGTGCTGCAGAAGCTGAAAAT
    GTTGATATGCGTTTACACAGAGTTATTTATAATGTTATCGAAGAAATTGAATCAGCGATG
    AAAGGTTTACTTGATCCAGAATTTGAAGAACAAGTTATCGGACAAGCTGAAGTTCGTCAA
    ACATTCAAAGTTTCTAAAGTTGGTACTATTGCTGGATGTTATGTTACTGAAGGTAAAATT
    ACGCGAAATGCTGGTGTACGTATTATTCGTGATGGTATTGTTCAATATGAAGGCGAATTA
    GATACACTTAAACGTTTCAAAGATGATGCTAAGGAAGTTGCAAAAGGTTATGAATGTGGT
    ATTACAATTGAAAACTACAATGACCTTAAAGAAGGCGATGTTATCGAAGCATTTGAAATG
    GTTGAAATTAAGCGTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2118

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS06295 [old locus tag: SA1112 ]
  • symbol: SA_RS06295
  • description: translation initiation factor IF-2
  • length: 705
  • theoretical pI: 4.83577
  • theoretical MW: 77856.1
  • GRAVY: -0.535319

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesisTranslation factorstranslation initiation factor IF-2 (TIGR00487; HMM-score: 909.1)
    Genetic information processingProtein synthesisTranslation factorstranslation initiation factor aIF-2 (TIGR00491; HMM-score: 171.6)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 135.8)
    Genetic information processingProtein synthesisTranslation factorsselenocysteine-specific translation elongation factor (TIGR00475; HMM-score: 91.2)
    Unknown functionGeneralelongation factor 4 (TIGR01393; EC 3.6.5.-; HMM-score: 73.2)
    Cellular processesCellular processesAdaptations to atypical conditionsGTP-binding protein TypA/BipA (TIGR01394; HMM-score: 65.7)
    Genetic information processingProtein synthesisTranslation factorsGTP-binding protein TypA/BipA (TIGR01394; HMM-score: 65.7)
    Signal transductionRegulatory functionsOtherGTP-binding protein TypA/BipA (TIGR01394; HMM-score: 65.7)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor G (TIGR00484; HMM-score: 52.3)
    translation initiation factor 2, gamma subunit (TIGR03680; HMM-score: 52)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor Tu (TIGR00485; HMM-score: 48)
    Genetic information processingProtein synthesisOtherribosome-associated GTPase EngA (TIGR03594; HMM-score: 44.8)
    MetabolismCentral intermediary metabolismSulfur metabolismsulfate adenylyltransferase, large subunit (TIGR02034; EC 2.7.7.4; HMM-score: 42.2)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor EF-1, subunit alpha (TIGR00483; HMM-score: 42)
    Genetic information processingProtein synthesisTranslation factorspeptide chain release factor 3 (TIGR00503; HMM-score: 38.9)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor aEF-2 (TIGR00490; HMM-score: 32.9)
    Genetic information processingProtein fateProtein modification and repair[FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 27.2)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsferrous iron transport protein B (TIGR00437; HMM-score: 19.6)
    Cellular processesCellular processesChemotaxis and motilityflagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 11.8)
    cobaltochelatase subunit (TIGR02442; EC 6.6.1.2; HMM-score: 2.7)
  • TheSEED:
  • PFAM:
    no clan definedIF-2; Translation-initiation factor 2 (PF11987; HMM-score: 128.8)
    P-loop_NTPase (CL0023) GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 128.8)
    HTH (CL0123) IF2_N; Translation initiation factor IF-2, N-terminal region (PF04760; HMM-score: 110.3)
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 43.5)
    EFTPs (CL0575) GTP_EFTU_D2; Elongation factor Tu domain 2 (PF03144; HMM-score: 29)
    P-loop_NTPase (CL0023) FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 25.1)
    Arf; ADP-ribosylation factor family (PF00025; HMM-score: 24.1)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 17.9)
    PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 16)
    HSP20 (CL0190) PIH1; pre-RNA processing PIH1/Nop17 (PF08190; HMM-score: 14.3)
    SIS (CL0067) SIS_2; SIS domain (PF13580; HMM-score: 14.1)
    P-loop_NTPase (CL0023) ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 13.6)
    no clan definedSpt20; Spt20 family (PF12090; HMM-score: 13.2)
    Tim54; Inner membrane protein import complex subunit Tim54 (PF11711; HMM-score: 12.2)
    PDDEXK (CL0236) eIF-3_zeta; Eukaryotic translation initiation factor 3 subunit 7 (eIF-3) (PF05091; HMM-score: 12)
    no clan definedNucleocapsid-N; Nucleocapsid protein N (PF11030; HMM-score: 12)
    RP-C_C; Replication protein C C-terminal region (PF11800; HMM-score: 11.4)
    DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 11)
    no clan definedDDHD; DDHD domain (PF02862; HMM-score: 9.9)
    CDC45; CDC45-like protein (PF02724; HMM-score: 8.6)
    Striatin; Striatin family (PF08232; HMM-score: 6.8)
    RRN3; RNA polymerase I specific transcription initiation factor RRN3 (PF05327; HMM-score: 6.7)
    Viral_ssRNA_CP (CL0055) TT_ORF1; TT viral orf 1 (PF02956; HMM-score: 6.6)
    no clan definedNdc1_Nup; Nucleoporin protein Ndc1-Nup (PF09531; HMM-score: 6)
    Peptidase_AD (CL0130) Presenilin; Presenilin (PF01080; HMM-score: 5.8)
    FUSC (CL0307) ALMT; Aluminium activated malate transporter (PF11744; HMM-score: 5.8)
    no clan definedGREB1; Gene regulated by oestrogen in breast cancer (PF15782; HMM-score: 3.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS00335PBP2a family beta-lactam-resistant peptidoglycan transpeptidase MecA  [1] (data from MRSA252)
    SA_RS0201530S ribosomal protein S6  [1] (data from MRSA252)
    SA_RS0291050S ribosomal protein L1  [1] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [1] (data from MRSA252)
    SA_RS0292050S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA_RS0295030S ribosomal protein S7  [1] (data from MRSA252)
    SA_RS02955elongation factor G  [1] (data from MRSA252)
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS03380metal ABC transporter substrate-binding protein  [1] (data from MRSA252)
    SA_RS05365dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [1] (data from MRSA252)
    SA_RS0829550S ribosomal protein L21  [1] (data from MRSA252)
    SA_RS0846050S ribosomal protein L20  [1] (data from MRSA252)
    SA_RS08470translation initiation factor IF-3  [1] (data from MRSA252)
    SA_RS08600universal stress protein  [1] (data from MRSA252)
    SA_RS08625universal stress protein UspA  [1] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [1] (data from MRSA252)
    SA_RS09810non-heme ferritin  [1] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [1] (data from MRSA252)
    SA_RS1163050S ribosomal protein L17  [1] (data from MRSA252)
    SA_RS1164030S ribosomal protein S11  [1] (data from MRSA252)
    SA_RS1164530S ribosomal protein S13  [1] (data from MRSA252)
    SA_RS1167050S ribosomal protein L15  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1169050S ribosomal protein L6  [1] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [1] (data from MRSA252)
    SA_RS1172030S ribosomal protein S17  [1] (data from MRSA252)
    SA_RS1173050S ribosomal protein L16  [1] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [1] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [1] (data from MRSA252)
    SA_RS1174530S ribosomal protein S19  [1] (data from MRSA252)
    SA_RS1175050S ribosomal protein L2  [1] (data from MRSA252)
    SA_RS1175550S ribosomal protein L23  [1] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [1] (data from MRSA252)
    SA_RS1176550S ribosomal protein L3  [1] (data from MRSA252)
    SA_RS12885methionine ABC transporter ATP-binding protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.143
    • Ymax_pos: 11
    • Cmax: 0.142
    • Cmax_pos: 38
    • Smax: 0.271
    • Smax_pos: 3
    • Smean: 0.194
    • D: 0.163
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 445965780 NCBI
  • RefSeq: WP_000043635 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MSKQRIYEYAKELNLKSKEIIDELKSMNIEVSNHMQALEDDQIKALDKKFKKEQKNDNKQSTQNNHQKSNNQNQNKGQQKDNKKNQQQNNKGNKGNKKNNRNNKKNNKNNKPQNQPAAPKEIPSKVTYQEGITVGEFADKLNVESSEIIKKLFLLGIVANINQSLNQETIELIADDYGVEVEEEVVINEEDLSIYFEDEKDDPEAIERPAVVTIMGHVDHGKTTLLDSIRHTKVTAGEAGGITQHIGAYQIENDGKKITFLDTPGHAAFTTMRARGAQVTDITILVVAADDGVMPQTIEAINHAKEAEVPIIVAVNKIDKPTSNPDRVMQELTEYGLIPEDWGGETIFVPLSALSGDGIDDLLEMIGLVAEVQELKANPKNRAVGTVIEAELDKSRGPSASLLVQNGTLNVGDAIVVGNTYGRIRAMVNDLGQRIKTAGPSTPVEITGINDVPQAGDRFVVFSDEKQARRIGESRHEASIVQQRQESKNVSLDNLFEQMKQGEMKDLNVIIKGDVQGSVEALAASLMKIDVEGVNVRIIHTAVGAINESDVTLANASNGIIIGFNVRPDSGAKRAAEAENVDMRLHRVIYNVIEEIESAMKGLLDPEFEEQVIGQAEVRQTFKVSKVGTIAGCYVTEGKITRNAGVRIIRDGIVQYEGELDTLKRFKDDAKEVAKGYECGITIENYNDLKEGDVIEAFEMVEIKR

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS06295 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]