From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS01085 [old locus tag: SA0182 ]
  • pan locus tag?: SAUPAN001030000
  • symbol: SA_RS01085
  • pan gene symbol?:
  • synonym:
  • product: pyruvate decarboxylase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS01085 [old locus tag: SA0182 ]
  • symbol: SA_RS01085
  • product: pyruvate decarboxylase
  • replicon: chromosome
  • strand: -
  • coordinates: 212901..214541
  • length: 1641
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (212901..214541) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    ATGAAACAACGCATTGGAGCTTACTTAATTGACGCTTTTCATCGAGCAGGCGTCGATAAA
    ATTTTTGGTGTTCCTGGTGATTTTAATCTCGCTTTTCTAGACGATATTATCAGCAATCCC
    AATGTAGATTGGGTAGGAAATACAAATGAATTAAACGCAAGTTACGCAGCGGACGGTTAT
    GCCCGTCTTAATGGACTCGCTGCATTAGTTACTACATTTGGTGTTGGCGAATTAAGTGCC
    GTCAACGGTATCGCAGGTTCATATGCTGAACGCATACCTGTCATTGCGATTACAGGTGCG
    CCGACACGTGCTGTTGAACAAGCCGGTAAATATGTACATCACTCACTTGGTGAAGGTACA
    TTTGACGACTACCGAAAAATGTTTGCACATATAACCGTTGCACAAGGTTATATCACACCT
    GAAAATGCAACAACCGAAATACCACGTTTAATTAATACAGCAATCGCCGAAAGACGCCCA
    GTTCATTTACATTTACCAATCGATGTCGCAATCTCTGAAATTGAGATACCGACACCATTT
    GAAGTGACGGCAACTAAAGATACGGATGCATCAACATATATAGAGTTATTAGCAACTAAA
    CTGCATCAAGCGAAGCAGCCTATCATCATTACTGGACATGAAATTAACAGTTTTCACCTC
    CATCAAGAATTAGAAGATTTTGTAAATCAAACACAGATACCAGTAGCACAACTTTCATTA
    GGAAAAGGTGCTTTTAATGAGGAAAATCCATATTATATGGGTATTTACGACGGGAAAATT
    GCCGAAGATAAAATACGAGATTATGTGGACAACAGCGATTTAATTTTAAATATTGGAGCC
    AAATTAACAGATTCAGCAACAGCAGGATTTTCATACCAATTCAATATCGATGATGTCGTT
    ATGTTAAATCATCACAATATCAAAATTGATGATGTTACAAATGATGAAATATCTCTACCA
    TCGTTGTTAAAACAGTTATCCAATATTTCATATACGAACAGTGCAACGTTCCCTGCGTAT
    CATCGTCCAACATCACCCGATTATACTGTTGGCACAGAACCATTAACACAACAAACTTAT
    TTTAAAATGATGCAAAATTTCTTAAAACCAAATGATGTCATTATTGCTGATCAAGGTACA
    TCATTCTTTGGTGCTTATGATTTAGCATTATACAAAAACAATACTTTTATAGGGCAACCG
    TTATGGGGTTCTATCGGCTATACATTACCTGCAACATTAGGTTCACAATTAGCAGACAAA
    GATCGTCGTAACTTATTATTAATTGGTGATGGCTCATTGCAACTAACTGTTCAAGCTATT
    TCAACTATGATTAGACAGCATATTAAACCGGTATTATTTGTGATTAATAATGACGGCTAT
    ACGGTAGAACGACTTATTCACGGCATGTATGAACCTTATAATGAAATTCACATGTGGGAT
    TATAAAGCTTTACCAGCTGTATTTGGTGGTAAAAATGTTGAAATTCATGACGTTGAATCA
    TCAAAAGATTTACAAGACACGTTTAATGCAATTAATGGTCATCCCGATGTGATGCATTTT
    GTCGAAGTCAAAATGTCTGTCGAAGACGCACCGAAGAAACTGATCGATATCGCTAAAGCT
    TTTTCACAACAAAATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1641

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS01085 [old locus tag: SA0182 ]
  • symbol: SA_RS01085
  • description: pyruvate decarboxylase
  • length: 546
  • theoretical pI: 4.9537
  • theoretical MW: 60526.9
  • GRAVY: -0.174359

Function[edit source | edit]

  • TIGRFAM:
    MetabolismCentral intermediary metabolismOtherindolepyruvate decarboxylase (TIGR03393; EC 4.1.1.74; HMM-score: 529.7)
    and 11 more
    indolepyruvate/phenylpyruvate decarboxylase (TIGR03394; EC 4.1.1.43,4.1.1.74; HMM-score: 201)
    MetabolismAmino acid biosynthesisPyruvate familyacetolactate synthase, large subunit, biosynthetic type (TIGR00118; EC 2.2.1.6; HMM-score: 158.6)
    MetabolismCentral intermediary metabolismOthersulfoacetaldehyde acetyltransferase (TIGR03457; EC 2.3.3.15; HMM-score: 100.2)
    MetabolismEnergy metabolismSugars3,5/4-trihydroxycyclohexa-1,2-dione hydrolase (TIGR04377; EC 3.7.1.-; HMM-score: 89.6)
    glyoxylate carboligase (TIGR01504; EC 4.1.1.47; HMM-score: 77.7)
    MetabolismEnergy metabolismFermentationacetolactate synthase, catabolic (TIGR02418; EC 2.2.1.6; HMM-score: 77.7)
    MetabolismEnergy metabolismAerobicpyruvate oxidase (TIGR02720; EC 1.2.3.3; HMM-score: 61.8)
    Cellular processesCellular processesDetoxificationoxalyl-CoA decarboxylase (TIGR03254; EC 4.1.1.8; HMM-score: 49.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (TIGR00173; EC 2.2.1.9; HMM-score: 42.5)
    sulfopyruvate decarboxylase, beta subunit (TIGR03846; EC 4.1.1.79; HMM-score: 19)
    MetabolismEnergy metabolismChemoautotrophyCO dehydrogenase/acetyl-CoA synthase complex, epsilon subunit (TIGR00315; EC 1.2.99.2; HMM-score: 14)
  • TheSEED:
  • PFAM:
    THDP-binding (CL0254) TPP_enzyme_N; Thiamine pyrophosphate enzyme, N-terminal TPP binding domain (PF02776; HMM-score: 117.2)
    and 3 more
    FAD_DHS (CL0085) TPP_enzyme_M; Thiamine pyrophosphate enzyme, central domain (PF00205; HMM-score: 84.7)
    THDP-binding (CL0254) TPP_enzyme_C; Thiamine pyrophosphate enzyme, C-terminal TPP binding domain (PF02775; HMM-score: 59.6)
    FAD_DHS (CL0085) CO_dh; CO dehydrogenase beta subunit/acetyl-CoA synthase epsilon subunit (PF02552; HMM-score: 14.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS01275formate acetyltransferase  [1] (data from MRSA252)
    SA_RS02095alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS08435trigger factor  [1] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS08760formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1175550S ribosomal protein L23  [1] (data from MRSA252)
    SA_RS13915ornithine carbamoyltransferase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.117
    • Ymax_pos: 31
    • Cmax: 0.139
    • Cmax_pos: 57
    • Smax: 0.17
    • Smax_pos: 30
    • Smean: 0.11
    • D: 0.114
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446736269 NCBI
  • RefSeq: WP_000813525 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKQRIGAYLIDAFHRAGVDKIFGVPGDFNLAFLDDIISNPNVDWVGNTNELNASYAADGYARLNGLAALVTTFGVGELSAVNGIAGSYAERIPVIAITGAPTRAVEQAGKYVHHSLGEGTFDDYRKMFAHITVAQGYITPENATTEIPRLINTAIAERRPVHLHLPIDVAISEIEIPTPFEVTATKDTDASTYIELLATKLHQAKQPIIITGHEINSFHLHQELEDFVNQTQIPVAQLSLGKGAFNEENPYYMGIYDGKIAEDKIRDYVDNSDLILNIGAKLTDSATAGFSYQFNIDDVVMLNHHNIKIDDVTNDEISLPSLLKQLSNISYTNSATFPAYHRPTSPDYTVGTEPLTQQTYFKMMQNFLKPNDVIIADQGTSFFGAYDLALYKNNTFIGQPLWGSIGYTLPATLGSQLADKDRRNLLLIGDGSLQLTVQAISTMIRQHIKPVLFVINNDGYTVERLIHGMYEPYNEIHMWDYKALPAVFGGKNVEIHDVESSKDLQDTFNAINGHPDVMHFVEVKMSVEDAPKKLIDIAKAFSQQNK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS01085 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]