From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS04780 [old locus tag: SA0842 ]
  • pan locus tag?: SAUPAN003127000
  • symbol: SA_RS04780
  • pan gene symbol?: fabH
  • synonym:
  • product: 3-oxoacyl-ACP synthase III

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS04780 [old locus tag: SA0842 ]
  • symbol: SA_RS04780
  • product: 3-oxoacyl-ACP synthase III
  • replicon: chromosome
  • strand: +
  • coordinates: 955150..956091
  • length: 942
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (955150..956091) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGAACGTGGGTATTAAAGGTTTTGGTGCATATGCACCAGAAAAGATTATTGACAATGCC
    TATTTTGAGCAATTTTTAGATACATCTGATGAATGGATTTCTAAGATGACTGGAATTAAA
    GAAAGACATTGGGCAGATGACGATCAAGATACTTCAGATTTAGCATATGAAGCAAGTGTA
    AAAGCAATCGCTGACGCTGGTATTCAGCCTGAAGATATAGATATGATAATTGTTGCCACA
    GCAACTGGAGATATGCCATTTCCAACTGTCGCAAATATGTTGCAAGAACGTTTAGGGACG
    GGCAAAGTTGCCTCTATGGATCAACTTGCAGCATGTTCTGGATTTATGTATTCAATGATT
    ACAGCTAAACAATATGTTCAATCTGGAGATTATCATAATATTTTAGTTGTCGGTGCAGAT
    AAATTATCTAAAATAACAGATTTAACTGACCGTTCTACTGCAGTTCTATTTGGAGATGGT
    GCAGGTGCGGTTATCATCGGTGAAGTTTCAGAAGGCAGAGGTATTATAAGTTATGAAATG
    GGTTCTGATGGCACTGGTGGTAAACATTTATATTTAGATAAAGATACTGGTAAACTGAAA
    ATGAATGGTCGAGAAGTATTTAAATTTGCTGTTAGAATTATGGGTGATGCATCAACACGT
    GTAGTTGAAAAAGCGAATTTAACATCAGATGATATAGATTTATTTATTCCTCATCAAGCT
    AATATTAGAATTATGGAATCAGCTAGAGAACGCTTAGGTATTTCAAAAGACAAAATGAGT
    GTTTCTGTAAATAAATATGGAAATACTTCAGCTGCGTCAATACCTTTAAGTATCGATCAA
    GAATTAAAAAATGGTAAACTCAAAGATGATGATACAATTGTTCTTGTCGGATTCGGTGGC
    GGCCTAACTTGGGGCGCAATGACAATAAAATGGGGAAAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    942

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS04780 [old locus tag: SA0842 ]
  • symbol: SA_RS04780
  • description: 3-oxoacyl-ACP synthase III
  • length: 313
  • theoretical pI: 4.64033
  • theoretical MW: 33879.2
  • GRAVY: -0.177955

Function[edit source | edit]

  • reaction:
    EC 2.3.1.41?  ExPASy
    Beta-ketoacyl-[acyl-carrier-protein] synthase IAcyl-[acyl-carrier-protein] + malonyl-[acyl-carrier-protein] = 3-oxoacyl-[acyl-carrier-protein] + CO2 + [acyl-carrier-protein]
    EC 2.3.1.180?  ExPASy
    Beta-ketoacyl-[acyl-carrier-protein] synthase IIIAcetyl-CoA + malonyl-[acyl-carrier-protein] = acetoacetyl-[acyl-carrier-protein] + CoA + CO2
  • TIGRFAM:
    MetabolismFatty acid and phospholipid metabolismBiosynthesis3-oxoacyl-[acyl-carrier-protein] synthase III (TIGR00747; EC 2.3.1.180; HMM-score: 407.7)
    and 5 more
    MetabolismFatty acid and phospholipid metabolismBiosynthesisputative hydroxymethylglutaryl-CoA synthase (TIGR00748; EC 2.3.3.10; HMM-score: 63.9)
    hydroxymethylglutaryl-CoA synthase (TIGR01835; EC 2.3.3.10; HMM-score: 32.4)
    MetabolismFatty acid and phospholipid metabolismOtheracetyl-CoA C-acyltransferase (TIGR01930; EC 2.3.1.16; HMM-score: 28.6)
    hydroxymethylglutaryl-CoA synthase (TIGR01833; EC 2.3.3.10; HMM-score: 18.2)
    Cellular processesCellular processesSporulation and germinationstage V sporulation protein AD (TIGR02845; HMM-score: 16.8)
  • TheSEED:
  • PFAM:
    Thiolase (CL0046) ACP_syn_III_C; 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III C terminal (PF08541; HMM-score: 128.6)
    and 9 more
    ACP_syn_III; 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III (PF08545; HMM-score: 98.4)
    Thiolase_N; Thiolase, N-terminal domain (PF00108; HMM-score: 39.2)
    Chal_sti_synt_N; Chalcone and stilbene synthases, N-terminal domain (PF00195; HMM-score: 23.5)
    SpoVAD; Stage V sporulation protein AD (SpoVAD) (PF07451; HMM-score: 21.4)
    HMG_CoA_synt_N; Hydroxymethylglutaryl-coenzyme A synthase N terminal (PF01154; HMM-score: 19.1)
    Chal_sti_synt_C; Chalcone and stilbene synthases, C-terminal domain (PF02797; HMM-score: 19)
    FAE1_CUT1_RppA; FAE1/Type III polyketide synthase-like protein (PF08392; HMM-score: 17.8)
    Thiolase_C; Thiolase, C-terminal domain (PF02803; HMM-score: 16.2)
    ketoacyl-synt; Beta-ketoacyl synthase, N-terminal domain (PF00109; HMM-score: 11.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS0201530S ribosomal protein S6  [1] (data from MRSA252)
    SA_RS02120hypothetical protein  [1] (data from MRSA252)
    SA_RS0294530S ribosomal protein S12  [1] (data from MRSA252)
    SA_RS0295030S ribosomal protein S7  [1] (data from MRSA252)
    SA_RS04025preprotein translocase subunit SecA  [1] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS05295phosphocarrier protein HPr  [1] (data from MRSA252)
    SA_RS06120signal recognition particle protein  [1] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS08470translation initiation factor IF-3  [1] (data from MRSA252)
    SA_RS08505aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS11010uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [1] (data from MRSA252)
    SA_RS1173050S ribosomal protein L16  [1] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [1] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [1] (data from MRSA252)
    SA_RS1175050S ribosomal protein L2  [1] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helix: 1
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.082
    • Ymax_pos: 26
    • Cmax: 0.106
    • Cmax_pos: 45
    • Smax: 0.11
    • Smax_pos: 18
    • Smean: 0.062
    • D: 0.074
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447023270 NCBI
  • RefSeq: WP_001100526 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNVGIKGFGAYAPEKIIDNAYFEQFLDTSDEWISKMTGIKERHWADDDQDTSDLAYEASVKAIADAGIQPEDIDMIIVATATGDMPFPTVANMLQERLGTGKVASMDQLAACSGFMYSMITAKQYVQSGDYHNILVVGADKLSKITDLTDRSTAVLFGDGAGAVIIGEVSEGRGIISYEMGSDGTGGKHLYLDKDTGKLKMNGREVFKFAVRIMGDASTRVVEKANLTSDDIDLFIPHQANIRIMESARERLGISKDKMSVSVNKYGNTSAASIPLSIDQELKNGKLKDDDTIVLVGFGGGLTWGAMTIKWGK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS04780 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]