From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS06120 [old locus tag: SA1080 ]
  • pan locus tag?: SAUPAN003524000
  • symbol: SA_RS06120
  • pan gene symbol?: ffh
  • synonym:
  • product: signal recognition particle protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS06120 [old locus tag: SA1080 ]
  • symbol: SA_RS06120
  • product: signal recognition particle protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1222306..1223673
  • length: 1368
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (1222306..1223673) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    ATGGCATTTGAAGGCTTATCAGAACGCCTGCAAGCGACGATGCAAAAAATGCGTGGTAAG
    GGTAAACTTACTGAAGCTGATATAAAGATAATGATGCGTGAAGTAAGATTAGCGTTATTT
    GAGGCTGACGTAAACTTTAAAGTGGTAAAAGAATTTATTAAAACAGTATCAGAACGCGCA
    TTAGGTTCCGATGTAATGCAATCATTAACACCAGGGCAACAAGTTATTAAAATAGTTCAA
    GATGAATTAACGAAGTTGATGGGTGGAGAAAATACATCGATTAATATGTCAAATAAACCA
    CCTACTGTTGTTATGATGGTTGGTTTACAAGGTGCTGGTAAAACAACAACTGCAGGTAAA
    TTAGCATTATTGATGCGTAAAAAATACAACAAAAAACCTATGTTAGTTGCAGCAGATATT
    TATCGTCCAGCAGCGATAAATCAATTACAAACAGTAGGGAAACAAATTGATATTCCTGTA
    TACAGTGAAGGAGATCAAGTAAAGCCACAACAAATTGTAACTAATGCATTAAAACATGCT
    AAAGAAGAACATTTAGACTTTGTAATCATTGATACAGCAGGTCGATTACACATCGATGAA
    GCATTGATGAACGAATTAAAAGAAGTAAAAGAAATTGCTAAACCAAACGAAATTATGTTA
    GTTGTCGATTCAATGACGGGTCAAGATGCTGTCAATGTTGCAGAATCTTTTGACGATCAA
    CTTGATGTCACAGGTGTTACCTTAACTAAATTAGATGGTGATACACGTGGTGGTGCAGCT
    TTATCTATTCGTTCGGTGACACAAAAACCAATTAAATTTGTTGGTATGAGTGAAAAGTTA
    GATGGTTTAGAGCTATTCCATCCTGAACGTATGGCATCACGTATTTTAGGTATGGGTGAT
    GTGTTAAGTTTAATTGAAAAAGCGCAACAAGATGTGGATCAAGAAAAAGCAAAAGATTTA
    GAGAAAAAGATGCGTGAGTCATCGTTTACTTTAGATGATTTTTTAGAACAACTTGATCAG
    GTGAAAAATCTAGGACCACTGGATGATATTATGAAAATGATTCCAGGTATGAATAAAATG
    AAAGGGCTAGATAAGCTTAATATGAGTGAAAAGCAAATTGATCATATTAAAGCGATTATC
    CAGTCAATGACGCCGGCTGAAAGAAACAATCCAGACACATTGAATGTATCACGTAAAAAG
    CGTATTGCTAAAGGGTCTGGTCGTTCATTACAAGAAGTCAATCGTTTGATGAAACAATTT
    AACGATATGAAGAAAATGATGAAACAATTCACTGGTGGCGGTAAAGGTAAAAAAGGTAAA
    CGCAATCAAATGCAAAATATGTTAAAAGGTATGAATTTACCGTTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1368

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS06120 [old locus tag: SA1080 ]
  • symbol: SA_RS06120
  • description: signal recognition particle protein
  • length: 455
  • theoretical pI: 10.0414
  • theoretical MW: 50753.1
  • GRAVY: -0.417143

Function[edit source | edit]

  • TIGRFAM:
    Genetic information processingProtein fateProtein and peptide secretion and traffickingsignal recognition particle protein (TIGR00959; HMM-score: 628.3)
    and 7 more
    signal recognition particle protein SRP54 (TIGR01425; HMM-score: 307.3)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingsignal recognition particle-docking protein FtsY (TIGR00064; HMM-score: 231.2)
    Cellular processesCellular processesChemotaxis and motilityflagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 67.8)
    exopolysaccharide/PEP-CTERM locus tyrosine autokinase (TIGR03018; EC 2.7.10.2; HMM-score: 21.3)
    MetabolismEnergy metabolismPhotosynthesisphotosystem II biogenesis protein Psp29 (TIGR03060; HMM-score: 17.1)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 15.7)
    MetabolismCentral intermediary metabolismSulfur metabolismadenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 12.5)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 257.6)
    and 21 more
    no clan definedSRP_SPB; Signal peptide binding domain (PF02978; HMM-score: 119.6)
    SRP54_N; SRP54-type protein, helical bundle domain (PF02881; HMM-score: 75.6)
    P-loop_NTPase (CL0023) Zeta_toxin; Zeta toxin (PF06414; HMM-score: 24.2)
    AAA_17; AAA domain (PF13207; HMM-score: 22.9)
    AAA_31; AAA domain (PF13614; HMM-score: 19.5)
    AAA_33; AAA domain (PF13671; HMM-score: 19.5)
    AAA_22; AAA domain (PF13401; HMM-score: 18.4)
    AAA_30; AAA domain (PF13604; HMM-score: 17.1)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 16.7)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 16.4)
    CbiA; CobQ/CobB/MinD/ParA nucleotide binding domain (PF01656; HMM-score: 15.9)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 14.5)
    APS_kinase; Adenylylsulphate kinase (PF01583; HMM-score: 14.3)
    6PF2K; 6-phosphofructo-2-kinase (PF01591; HMM-score: 13.7)
    AAA_25; AAA domain (PF13481; HMM-score: 13.3)
    HTH (CL0123) Tn7_Tnp_TnsA_C; TnsA endonuclease C terminal (PF08721; HMM-score: 13.2)
    P-loop_NTPase (CL0023) Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 13)
    ABC_tran; ABC transporter (PF00005; HMM-score: 12.7)
    AAA_24; AAA domain (PF13479; HMM-score: 8.9)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 7.8)
    KTI12; Chromatin associated protein KTI12 (PF08433; HMM-score: 7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS11130(deoA)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA_RS00335PBP2a family beta-lactam-resistant peptidoglycan transpeptidase MecA  [1] (data from MRSA252)
    SA_RS01085pyruvate decarboxylase  [1] (data from MRSA252)
    SA_RS017105'-nucleotidase, lipoprotein e(P4) family  [1] (data from MRSA252)
    SA_RS0201530S ribosomal protein S6  [1] (data from MRSA252)
    SA_RS02600ribosomal RNA small subunit methyltransferase A  [1] (data from MRSA252)
    SA_RS02615pur operon repressor  [1] (data from MRSA252)
    SA_RS02635bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase  [1] (data from MRSA252)
    SA_RS0290550S ribosomal protein L11  [1] (data from MRSA252)
    SA_RS0291050S ribosomal protein L1  [1] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [1] (data from MRSA252)
    SA_RS0292050S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA_RS0294530S ribosomal protein S12  [1] (data from MRSA252)
    SA_RS0295030S ribosomal protein S7  [1] (data from MRSA252)
    SA_RS02955elongation factor G  [1] (data from MRSA252)
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS03405N-acetylmannosaminyltransferase  [1] (data from MRSA252)
    SA_RS03645hypothetical protein  [1] (data from MRSA252)
    SA_RS03910ribonucleotide-diphosphate reductase subunit alpha  [1] (data from MRSA252)
    SA_RS04025preprotein translocase subunit SecA  [1] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [1] (data from MRSA252)
    SA_RS05325ribonuclease J 1  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS05365dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    SA_RS05860cell division protein FtsZ  [1] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS06295translation initiation factor IF-2  [1] (data from MRSA252)
    SA_RS0631530S ribosomal protein S15  [1] (data from MRSA252)
    SA_RS06325ribonuclease J 2  [1] (data from MRSA252)
    SA_RS07060dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS070652-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [1] (data from MRSA252)
    SA_RS07955molecular chaperone DnaK  [1] (data from MRSA252)
    SA_RS08030RNA-binding protein  [1] (data from MRSA252)
    SA_RS0829550S ribosomal protein L21  [1] (data from MRSA252)
    SA_RS0846050S ribosomal protein L20  [1] (data from MRSA252)
    SA_RS08470translation initiation factor IF-3  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS08600universal stress protein  [1] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [1] (data from MRSA252)
    SA_RS09055S-adenosylmethionine synthase  [1] (data from MRSA252)
    SA_RS10845DEAD/DEAH box family ATP-dependent RNA helicase  [1] (data from MRSA252)
    SA_RS1105050S ribosomal protein L31 type B  [1] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [1] (data from MRSA252)
    SA_RS1164030S ribosomal protein S11  [1] (data from MRSA252)
    SA_RS1164530S ribosomal protein S13  [1] (data from MRSA252)
    SA_RS1167050S ribosomal protein L15  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1169050S ribosomal protein L6  [1] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [1] (data from MRSA252)
    SA_RS1171050S ribosomal protein L24  [1] (data from MRSA252)
    SA_RS1172550S ribosomal protein L29  [1] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [1] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [1] (data from MRSA252)
    SA_RS1174530S ribosomal protein S19  [1] (data from MRSA252)
    SA_RS1175050S ribosomal protein L2  [1] (data from MRSA252)
    SA_RS1175550S ribosomal protein L23  [1] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [1] (data from MRSA252)
    SA_RS1176550S ribosomal protein L3  [1] (data from MRSA252)
    SA_RS1177030S ribosomal protein S10  [1] (data from MRSA252)
    SA_RS13920arginine deiminase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.122
    • Ymax_pos: 20
    • Cmax: 0.111
    • Cmax_pos: 20
    • Smax: 0.156
    • Smax_pos: 10
    • Smean: 0.117
    • D: 0.12
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446786212 NCBI
  • RefSeq: WP_000863468 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MAFEGLSERLQATMQKMRGKGKLTEADIKIMMREVRLALFEADVNFKVVKEFIKTVSERALGSDVMQSLTPGQQVIKIVQDELTKLMGGENTSINMSNKPPTVVMMVGLQGAGKTTTAGKLALLMRKKYNKKPMLVAADIYRPAAINQLQTVGKQIDIPVYSEGDQVKPQQIVTNALKHAKEEHLDFVIIDTAGRLHIDEALMNELKEVKEIAKPNEIMLVVDSMTGQDAVNVAESFDDQLDVTGVTLTKLDGDTRGGAALSIRSVTQKPIKFVGMSEKLDGLELFHPERMASRILGMGDVLSLIEKAQQDVDQEKAKDLEKKMRESSFTLDDFLEQLDQVKNLGPLDDIMKMIPGMNKMKGLDKLNMSEKQIDHIKAIIQSMTPAERNNPDTLNVSRKKRIAKGSGRSLQEVNRLMKQFNDMKKMMKQFTGGGKGKKGKRNQMQNMLKGMNLPF

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS06120 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 1.62 1.63 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]