From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS13920 [old locus tag: SA2428 ]
  • pan locus tag?: SAUPAN006364000
  • symbol: SA_RS13920
  • pan gene symbol?: arcA
  • synonym:
  • product: arginine deiminase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS13920 [old locus tag: SA2428 ]
  • symbol: SA_RS13920
  • product: arginine deiminase
  • replicon: chromosome
  • strand: -
  • coordinates: 2725603..2726838
  • length: 1236
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (2725603..2726838) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    ATGACAGATGGTCCAATTAAAGTAAATAGCGAAATTGGAGCTTTAAAAACTGTGTTACTT
    AAGCGTCCTGGAAAAGAATTAGAAAATTTAGTACCTGATTATTTAGATGGATTACTATTT
    GATGATATTCCATATTTAGAAGTAGCTCAAAAAGAGCATGACCATTTTGCGCAGGTGCTA
    AGAGAAGAGGGTGTTGAAGTACTTTACCTTGAGAAGTTAGCAGCTGAAAGTATTGAAAAT
    CCTCAAGTAAGAAGTGAATTTATTGATGATGTATTAGCAGAGTCTAAAAAAACAATATTA
    GGTCATGAAGAAGAAATTAAGACATTATTTGCGACACTTTCTAATCAAGAACTTGTAGAT
    AAAATAATGTCAGGGGTACGTAAGGAAGAAATTAATCCGAAATGTACACATCTAGTAGAG
    TACATGGATGATAAGTATCCATTCTATTTAGATCCAATGCCAAACCTTTATTTTACTAGA
    GATCCACAAGCCTCAATAGGACACGGTATAACAATCAATCGGATGTTCTGGAGAGCACGA
    CGACGAGAATCAATATTTATTCAATATATTGTAAAGCATCATCCTAGATTTAAAGATGCG
    AATATTCCAATCTGGTTAGATCGAGATTGCCCATTCAATATTGAAGGCGGCGATGAACTT
    GTTTTATCTAAAGATGTCTTGGCTATAGGCGTTTCAGAACGTACATCTGCACAAGCTATT
    GAAAAGTTAGCGCGACGTATTTTTGAAAATCCGCAGGCGACGTTTAAAAAAGTAGTAGCA
    ATTGAAATTCCAACTAGTCGAACTTTTATGCACTTAGATACAGTATTTACAATGATAGAT
    TATGACAAATTTACAATGCATTCAGCCATTTTAAAGGCAGAAGGCAATATGAATATATTT
    ATTATTGAATATGATGACGTAAATAAAGATATTGCCATCAAACAATCTAGTCATTTAAAA
    GATACTTTAGAAGACGTACTAGGTATAGATGATATCCAATTCATTCCAACAGGAAATGGT
    GATGTCATTGATGGTGCTAGAGAGCAATGGAATGATGGCTCAAATACATTATGTATAAGA
    CCAGGCGTTGTAGTGACTTACGATAGAAACTATGTATCGAATGATTTATTGAGACAAAAA
    GGCATAAAAGTCATTGAAATATCTGGTAGCGAGCTGGTACGTGGACGTGGGGGCCCTAGA
    TGTATGAGTCAACCACTATTCAGAGAAGACATTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1236

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS13920 [old locus tag: SA2428 ]
  • symbol: SA_RS13920
  • description: arginine deiminase
  • length: 411
  • theoretical pI: 4.87271
  • theoretical MW: 46944.3
  • GRAVY: -0.316788

Function[edit source | edit]

  • reaction:
    EC 3.5.3.6?  ExPASy
    Arginine deiminaseL-arginine + H2O = L-citrulline + NH3
  • TIGRFAM:
    MetabolismEnergy metabolismAmino acids and aminesarginine deiminase (TIGR01078; EC 3.5.3.6; HMM-score: 543.9)
  • TheSEED:
  • PFAM:
    GME (CL0197) Amidinotransf; Amidinotransferase (PF02274; HMM-score: 400.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS0265050S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [1] (data from MRSA252)
    SA_RS0295030S ribosomal protein S7  [1] (data from MRSA252)
    SA_RS03645hypothetical protein  [1] (data from MRSA252)
    SA_RS04025preprotein translocase subunit SecA  [1] (data from MRSA252)
    SA_RS04160enolase  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS07060dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [1] (data from MRSA252)
    SA_RS08150alanine--tRNA ligase  [1] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.101
    • Ymax_pos: 27
    • Cmax: 0.105
    • Cmax_pos: 25
    • Smax: 0.155
    • Smax_pos: 24
    • Smean: 0.093
    • D: 0.098
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446051562 NCBI
  • RefSeq: WP_000129417 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTDGPIKVNSEIGALKTVLLKRPGKELENLVPDYLDGLLFDDIPYLEVAQKEHDHFAQVLREEGVEVLYLEKLAAESIENPQVRSEFIDDVLAESKKTILGHEEEIKTLFATLSNQELVDKIMSGVRKEEINPKCTHLVEYMDDKYPFYLDPMPNLYFTRDPQASIGHGITINRMFWRARRRESIFIQYIVKHHPRFKDANIPIWLDRDCPFNIEGGDELVLSKDVLAIGVSERTSAQAIEKLARRIFENPQATFKKVVAIEIPTSRTFMHLDTVFTMIDYDKFTMHSAILKAEGNMNIFIIEYDDVNKDIAIKQSSHLKDTLEDVLGIDDIQFIPTGNGDVIDGAREQWNDGSNTLCIRPGVVVTYDRNYVSNDLLRQKGIKVIEISGSELVRGRGGPRCMSQPLFREDI

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS13920 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]