From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2534 [new locus tag: NWMN_RS14560 ]
  • pan locus tag?: SAUPAN006364000
  • symbol: arcA
  • pan gene symbol?: arcA
  • synonym:
  • product: arginine deiminase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_2534 [new locus tag: NWMN_RS14560 ]
  • symbol: arcA
  • product: arginine deiminase
  • replicon: chromosome
  • strand: -
  • coordinates: 2787869..2789104
  • length: 1236
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    ATGACAGATGGTCCAATTAAAGTAAATAGCGAAATTGGAGCTTTAAAAACTGTGTTACTT
    AAGCGTCCTGGAAAAGAATTAGAAAATTTAGTACCTGATTATTTAGATGGATTACTATTT
    GATGATATTCCATATTTAGAAGTAGCTCAAAAAGAGCATGACCATTTTGCGCAGGTGCTA
    AGAGAAGAGGGTGTTGAAGTACTTTACCTTGAGAAGTTAGCAGCTGAAAGTATTGAAAAT
    CCTCAAGTAAGAAGTGAATTTATTGATGATGTATTAGCAGAGTCTAAAAAAACAATATTA
    GGTCATGAAGAAGAAATTAAGGCATTATTTGCGACACTTTCTAATCAAGAACTTGTAGAT
    AAAATAATGTCAGGGGTACGTAAGGAAGAAATTAATCCGAAATGTACACATCTAGTAGAG
    TATATGGATGATAAGTATCCATTCTATTTAGATCCAATGCCAAACCTTTATTTTACTAGA
    GATCCACAAGCCTCAATAGGACACGGTATAACAATCAATCGGATGTTCTGGAGAGCACGA
    CGACGAGAATCAATATTTATTCAATATATTGTAAAGCATCATCCTAGATTTAAAGATGCG
    AATATTCCAATCTGGTTAGATCGAGATTGCCCATTCAATATTGAAGGCGGCGATGAACTT
    GTTTTATCTAAAGATGTCTTGGCTATAGGCGTTTCAGAACGTACATCTGCACAAGCTATT
    GAAAAGTTAGCGCGACGTATTTTTGAAAATCCGCAGGCGACGTTTAAAAAAGTAGTAGCA
    ATTGAAATTCCAACTAGTCGAACTTTTATGCACTTAGATACAGTATTTACAATGATAGAT
    TATGACAAATTTACAATGCATTCAGCCATTTTAAAGGCAGAAGGCAATATGAATATATTT
    ATTATTGAATATGATGACGTAAATAAAGATATTGCCATCAAACAATCTAGTCATTTAAAA
    GATACTTTAGAAGACGTACTAGGTATAGATGATATCCAATTCATTCCAACAGGAAATGGT
    GATGTCATTGATGGTGCTAGAGAGCAATGGAATGATGGCTCAAATACATTATGTATAAGA
    CCAGGCGTTGTAGTGACTTACGATAGAAACTATGTATCGAATGATTTATTGAGACAAAAA
    GGCATTAAAGTCATTGAAATATCTGGTAGCGAGTTGGTACGTGGACGTGGGGGCCCTAGA
    TGTATGAGTCAACCATTATTCAGAGAAGACATTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1236

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_2534 [new locus tag: NWMN_RS14560 ]
  • symbol: ArcA
  • description: arginine deiminase
  • length: 411
  • theoretical pI: 4.87271
  • theoretical MW: 46914.3
  • GRAVY: -0.310706

Function[edit source | edit]

  • reaction:
    EC 3.5.3.6?  ExPASy
    Arginine deiminaseL-arginine + H2O = L-citrulline + NH3
  • TIGRFAM:
    MetabolismEnergy metabolismAmino acids and aminesarginine deiminase (TIGR01078; EC 3.5.3.6; HMM-score: 544.2)
  • TheSEED:  
    Amino Acids and DerivativesArginine; urea cycle, polyaminesArginine and Ornithine Degradation Arginine deiminase (EC 3.5.3.6) 
    Arginine; urea cycle, polyaminesArginine Deiminase Pathway Arginine deiminase (EC 3.5.3.6) 
  • PFAM:
    GME (CL0197) Amidinotransf; Amidinotransferase (PF02274; HMM-score: 400.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_1519(alaS)alanyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_0745(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    NWMN_0961(pdhC)branched-chain alpha-keto acid dehydrogenase subunit E2  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_0960(phdB)pyruvate dehydrogenase E1 component, beta subunit  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_2147(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    NWMN_0464(rplY)50S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    NWMN_0508(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    NWMN_0722(secA)preprotein translocase subunit SecA  [1] (data from MRSA252)
    NWMN_1325(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    NWMN_0651hypothetical protein  [1] (data from MRSA252)
    NWMN_1382DNA-binding protein HU  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.101
    • Ymax_pos: 27
    • Cmax: 0.105
    • Cmax_pos: 25
    • Smax: 0.155
    • Smax_pos: 24
    • Smean: 0.093
    • D: 0.098
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTDGPIKVNSEIGALKTVLLKRPGKELENLVPDYLDGLLFDDIPYLEVAQKEHDHFAQVLREEGVEVLYLEKLAAESIENPQVRSEFIDDVLAESKKTILGHEEEIKALFATLSNQELVDKIMSGVRKEEINPKCTHLVEYMDDKYPFYLDPMPNLYFTRDPQASIGHGITINRMFWRARRRESIFIQYIVKHHPRFKDANIPIWLDRDCPFNIEGGDELVLSKDVLAIGVSERTSAQAIEKLARRIFENPQATFKKVVAIEIPTSRTFMHLDTVFTMIDYDKFTMHSAILKAEGNMNIFIIEYDDVNKDIAIKQSSHLKDTLEDVLGIDDIQFIPTGNGDVIDGAREQWNDGSNTLCIRPGVVVTYDRNYVSNDLLRQKGIKVIEISGSELVRGRGGPRCMSQPLFREDI

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulators: NWMN_1953 (Rex*), NWMN_2530 (ArcR*), AhrC (ArgR*), CcpA
    Rex* (TF) important in Energy metabolismRegPrecise
    ArcR* (TF) important in Arginine degradationRegPrecise
    AhrC  (ArgR*) (TF) important in Arginine biosynthesis, Arginine degradationRegPrecise
    CcpA (TF) important in Carbon catabolismRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]