From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS05590 [old locus tag: SA0986 ]
  • pan locus tag?: SAUPAN003375000
  • symbol: SA_RS05590
  • pan gene symbol?: pheT
  • synonym:
  • product: phenylalanine--tRNA ligase subunit beta

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS05590 [old locus tag: SA0986 ]
  • symbol: SA_RS05590
  • product: phenylalanine--tRNA ligase subunit beta
  • replicon: chromosome
  • strand: +
  • coordinates: 1115371..1117773
  • length: 2403
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (1115371..1117773) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    ATGTTGATATCAAATGAATGGTTGAAAGAATATGTAACAATCGATGATTCTGTAAGTGAT
    TTGGCAGAACGTATTACGCGCACAGGTATTGAAGTGGATGATTTAATTGACTACACAAAA
    GATATCAAAAATTTAGTTGTCGGTTTCGTTAAGTCAAAAGAGAAACATCCTGATGCCGAT
    AAATTAAATGTTTGCCAAGTTGATATCGGAGAAGACGAACCTGTACAAATCGTATGTGGT
    GCACCGAACGTTGATGCAGGACAATATGTCATTGTTGCTAAAGTAGGTGGCAGATTGCCT
    GGTGGTATTAAAATTAAGCGTGCCAAATTACGCGGTGAACGTTCAGAAGGTATGATTTGT
    TCGTTACAAGAAATTGGTATTTCAAGTAACTATATACCGAAAAGTTTTGAATCAGGCATT
    TATGTTTTTAGTGAATCCCAAGTTCCAGGAACAGATGCCTTACAAGCTTTATATTTAGAT
    GATCAAGTAATGGAATTTGATTTAACGCCGAATCGTGCAGATGCTTTAAGTATGATAGGT
    ACTGCTTATGAAGTTGCAGCATTATATAATACAAAAATGACTAAGCCAGAGACAACATCA
    AATGAGCTTGAGTTATCTGCAAATGATGAATTGACTGTGACAATTGAAAATGAAGATAAA
    GTACCATATTATAGTGCACGTGTTGTTCACGACGTGACAATTGAACCTTCGCCAATTTGG
    ATGCAAGCACGCTTAATAAAAGCGGGTATACGTCCTATTAATAATGTTGTTGACATTTCA
    AATTATGTGTTATTAGAATACGGTCAACCATTGCACATGTTTGATCAAGATGCGATTGGT
    TCACAACAAATTGTTGTTCGTCAAGCTAATGAAGGCGAAAAAATGACAACATTAGATGAT
    ACAGAACGTGAATTATTAACGAGCGATATTGTCATTACTAATGGACAAACTCCAATTGCA
    TTAGCTGGTGTTATGGGTGGCGATTTTTCAGAAGTTAAAGAACAAACATCAAATATAGTG
    ATTGAAGGTGCTATTTTTGATCCAGTTTCAATTCGTCATACATCAAGACGTTTAAATTTA
    CGCAGTGAATCATCTAGTCGTTTTGAAAAAGGAATAGCTACTGAATTTGTAGATGAAGCA
    GTCGACCGTGCATGTTATTTATTACAAACTTATGCAAACGGAAAAGTGCTAAAAGATAGA
    GTGTCTTCAGGAGAACTTGGTGCATTTATTACACCAATCGACATCACTGCTGATAAAATT
    AATCGCACTATTGGATTTGATTTGTCACAAAATGATATTGTTACTATTTTTAATCAACTA
    GGGTTTGATACAGAAATAAATGATGATGTTATTACAGTGCTAGTACCATCACGTCGTAAA
    GATATTACAATTAAAGAAGATTTAATTGAAGAAGTTGCACGTATATATGGATACGACGAT
    ATTCCATCAACGTTACCTGTCTTCGATAAAGTTACTAGTGGTCAGCTAACTGATCGCCAA
    TATAAAACTAGAATGGTTAAAGAAGTGTTAGAAGGTGCTGGATTAGATCAAGCTATTACG
    TATTCGTTAGTTTCTAAAGAGGATGCTACTGCATTTTCGATGCAACAGCGTCAAACAATT
    GATTTATTGATGCCAATGAGTGAAGCGCATGCGTCATTACGTCAAAGTTTATTACCACAT
    TTAATCGAAGCAGCATCATATAATGTGGCACGCAAAAATAAAGATGTAAAATTATTTGAA
    ATCGGCAATGTCTTCTTTGCTAATGGAGAAGGTGAACTACCAGATCAAGTTGAATATTTA
    AGTGGTATTTTAACTGGAGATTATGTAGTCAATCAATGGCAAGGTAAGAAAGAAACGGTT
    GATTTCTATTTAGCAAAAGGTGTCGTGGATCGAGTATCTGAAAAGTTAAACCTTGAATTT
    AGTTATCGTCGTGCTGATATTGATGGATTACATCCAGGTCGTACTGCTGAAATCTTATTA
    GAGAATAAAGTTGTTGGTTTTATTGGTGAATTACATCCAACATTAGCAGCTGATAATGAT
    TTAAAACGTACGTATGTTTTTGAGTTGAATTTTGATGCATTAATGGCTGTGTCGGTAGGT
    TACATTAATTACCAGCCAATTCCGAGATTCCCAGGCATGTCTCGTGACATTGCATTAGAA
    GTAGATCAAAATATTCCAGCAGCTGATTTATTATCAACGATTCATGCACACGGTGGCAAT
    ATATTAAAAGATACACTTGTCTTTGATGTATATCAGGGCGAACATTTAGAAAAAGGTAAA
    AAATCAATTGCAATACGTTTAAATTATTTAGACACAGAAGAAACATTGACAGATGAGCGC
    GTTTCAAAAGTGCAAGCGGAAATTGAAGCAGCATTAATTGAACAAGGTGCTGTTATTAGA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2403

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS05590 [old locus tag: SA0986 ]
  • symbol: SA_RS05590
  • description: phenylalanine--tRNA ligase subunit beta
  • length: 800
  • theoretical pI: 4.4077
  • theoretical MW: 88939
  • GRAVY: -0.20225

Function[edit source | edit]

  • reaction:
    EC 6.1.1.20?  ExPASy
    Phenylalanine--tRNA ligaseATP + L-phenylalanine + tRNA(Phe) = AMP + diphosphate + L-phenylalanyl-tRNA(Phe)
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA aminoacylationphenylalanine--tRNA ligase, beta subunit (TIGR00472; EC 6.1.1.20; HMM-score: 867.5)
    Genetic information processingProtein synthesistRNA aminoacylationphenylalanine--tRNA ligase, beta subunit (TIGR00471; EC 6.1.1.20; HMM-score: 148.3)
    Genetic information processingProtein synthesistRNA aminoacylationmethionine--tRNA ligase, beta subunit (TIGR00399; EC 6.1.1.10; HMM-score: 26.9)
    Genetic information processingProtein synthesistRNA aminoacylationphenylalanine--tRNA ligase (TIGR00469; EC 6.1.1.20; HMM-score: 26.6)
  • TheSEED:
  • PFAM:
    PheT-TilS (CL0383) B3_4; B3/4 domain (PF03483; HMM-score: 220.5)
    no clan definedFDX-ACB; Ferredoxin-fold anticodon binding domain (PF03147; HMM-score: 87.4)
    OB (CL0021) tRNA_bind; Putative tRNA binding domain (PF01588; HMM-score: 82.1)
    no clan definedB5; tRNA synthetase B5 domain (PF03484; HMM-score: 75.2)
    Peptidase_MA (CL0126) Peptidase_M41; Peptidase family M41 (PF01434; HMM-score: 13.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:
  • protein partners:
    SA_RS02955elongation factor G  [1] (data from MRSA252)
    SA_RS0612530S ribosomal protein S16  [1] (data from MRSA252)
    SA_RS06165succinyl-CoA ligase subunit beta  [1] (data from MRSA252)
    SA_RS07695elongation factor P  [1] (data from MRSA252)
    SA_RS0846050S ribosomal protein L20  [1] (data from MRSA252)
    SA_RS08865dipeptidase PepV  [1] (data from MRSA252)
    SA_RS10535molecular chaperone GroEL  [1] (data from MRSA252)
    SA_RS11060aldehyde dehydrogenase family protein  [1] (data from MRSA252)
    SA_RS1164030S ribosomal protein S11  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1176550S ribosomal protein L3  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.097
    • Ymax_pos: 61
    • Cmax: 0.114
    • Cmax_pos: 53
    • Smax: 0.105
    • Smax_pos: 59
    • Smean: 0.068
    • D: 0.086
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446831713 NCBI
  • RefSeq: WP_000908969 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MLISNEWLKEYVTIDDSVSDLAERITRTGIEVDDLIDYTKDIKNLVVGFVKSKEKHPDADKLNVCQVDIGEDEPVQIVCGAPNVDAGQYVIVAKVGGRLPGGIKIKRAKLRGERSEGMICSLQEIGISSNYIPKSFESGIYVFSESQVPGTDALQALYLDDQVMEFDLTPNRADALSMIGTAYEVAALYNTKMTKPETTSNELELSANDELTVTIENEDKVPYYSARVVHDVTIEPSPIWMQARLIKAGIRPINNVVDISNYVLLEYGQPLHMFDQDAIGSQQIVVRQANEGEKMTTLDDTERELLTSDIVITNGQTPIALAGVMGGDFSEVKEQTSNIVIEGAIFDPVSIRHTSRRLNLRSESSSRFEKGIATEFVDEAVDRACYLLQTYANGKVLKDRVSSGELGAFITPIDITADKINRTIGFDLSQNDIVTIFNQLGFDTEINDDVITVLVPSRRKDITIKEDLIEEVARIYGYDDIPSTLPVFDKVTSGQLTDRQYKTRMVKEVLEGAGLDQAITYSLVSKEDATAFSMQQRQTIDLLMPMSEAHASLRQSLLPHLIEAASYNVARKNKDVKLFEIGNVFFANGEGELPDQVEYLSGILTGDYVVNQWQGKKETVDFYLAKGVVDRVSEKLNLEFSYRRADIDGLHPGRTAEILLENKVVGFIGELHPTLAADNDLKRTYVFELNFDALMAVSVGYINYQPIPRFPGMSRDIALEVDQNIPAADLLSTIHAHGGNILKDTLVFDVYQGEHLEKGKKSIAIRLNYLDTEETLTDERVSKVQAEIEAALIEQGAVIR

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS05590 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]