From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS08510 [old locus tag: SA1511 ]
  • pan locus tag?: SAUPAN004310000
  • symbol: SA_RS08510
  • pan gene symbol?: coaE
  • synonym:
  • product: dephospho-CoA kinase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS08510 [old locus tag: SA1511 ]
  • symbol: SA_RS08510
  • product: dephospho-CoA kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 1720570..1721193
  • length: 624
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (1720570..1721193) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGCCGAAAGTTATTGGTCTAACAGGTGGAATCGCCTCAGGAAAATCAACAGTATCAGAA
    CTCTTATCCGTATTCGGTTTTAAAGTAGTAGATGCTGATAAAGCAGCCAGGGAAGCTGTT
    AAAAAGGGGAGTAAAGGTTTAGCTCAAGTACGAGAAGTCTTTGGTGATGAAGCAATTGAT
    GAAAATGGTGAGATGAATCGTCGTTATATGGGTGATTTAGTGTTTAACCATCCAGAAAAA
    CGCTTAGAATTAAATGCTATCATACATCCTATCGTGCGAGATATTATGGAAGAAGAAAAG
    CAAGAATATTTAAAACAAGGATATAATGTAATCATGGATATTCCATTATTATTTGAAAAT
    GAATTGGAAAATACAGTAGACGAAGTGTGGGTTGTATACACTTCTGAAAGTATACAAATG
    GATCGTTTAATGCAACGTAATAATCTGTCATTAGAAGATGCGAAAGCACGTGTCTATAGC
    CAAATTTCTATTGATAAAAAAAGCCGAATGGCCGATCATGTTATCGATAATTTAGGGGAT
    AAACTTGAATTAAAACAAAACCTTGAGAGATTGTTAGAAGAAGAAGGTTATATTGAAAAG
    CCGAATTACGGAGAAGAAGATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    624

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS08510 [old locus tag: SA1511 ]
  • symbol: SA_RS08510
  • description: dephospho-CoA kinase
  • length: 207
  • theoretical pI: 4.47247
  • theoretical MW: 23622.6
  • GRAVY: -0.518358

Function[edit source | edit]

  • reaction:
    EC 2.7.1.24?  ExPASy
    Dephospho-CoA kinaseATP + 3'-dephospho-CoA = ADP + CoA
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme Adephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 195.3)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) CoaE; Dephospho-CoA kinase (PF01121; HMM-score: 196.8)
    AAA_33; AAA domain (PF13671; HMM-score: 24.4)
    AAA_18; AAA domain (PF13238; HMM-score: 21.4)
    AAA_28; AAA domain (PF13521; HMM-score: 16.6)
    AAA_17; AAA domain (PF13207; HMM-score: 16.5)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 15.8)
    Peptidase_MA (CL0126) Peptidase_MA_2; Peptidase MA superfamily (PF13485; HMM-score: 14.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS01365L-lactate dehydrogenase  [1] (data from MRSA252)
    SA_RS02490YbaB/EbfC family nucleoid-associated protein  [1] (data from MRSA252)
    SA_RS02710cysteine synthase  [1] (data from MRSA252)
    SA_RS02900transcription termination/antitermination protein NusG  [1] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [1] (data from MRSA252)
    SA_RS0295030S ribosomal protein S7  [1] (data from MRSA252)
    SA_RS03250zinc-dependent alcohol dehydrogenase  [1] (data from MRSA252)
    SA_RS03915ribonucleotide-diphosphate reductase subunit beta  [1] (data from MRSA252)
    SA_RS04160enolase  [1] (data from MRSA252)
    SA_RS04680glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SA_RS05190bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS06490glutamine synthetase  [1] (data from MRSA252)
    SA_RS06645catalase  [1] (data from MRSA252)
    SA_RS07210alanine dehydrogenase  [1] (data from MRSA252)
    SA_RS07605phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)  [1] (data from MRSA252)
    SA_RS07880glycine--tRNA ligase  [1] (data from MRSA252)
    SA_RS07955molecular chaperone DnaK  [1] (data from MRSA252)
    SA_RS08110transcription elongation factor GreA  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [1] (data from MRSA252)
    SA_RS10010thioredoxin family protein  [1] (data from MRSA252)
    SA_RS11090DNA-directed RNA polymerase subunit delta  [1] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [1] (data from MRSA252)
    SA_RS1164530S ribosomal protein S13  [1] (data from MRSA252)
    SA_RS11660adenylate kinase  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [1] (data from MRSA252)
    SA_RS1175050S ribosomal protein L2  [1] (data from MRSA252)
    SA_RS13340pyruvate oxidase  [1] (data from MRSA252)
    SA_RS13375hydroxymethylglutaryl-CoA synthase  [1] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.209
    • Ymax_pos: 33
    • Cmax: 0.145
    • Cmax_pos: 33
    • Smax: 0.446
    • Smax_pos: 31
    • Smean: 0.259
    • D: 0.228
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447049911 NCBI
  • RefSeq: WP_001127167 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MPKVIGLTGGIASGKSTVSELLSVFGFKVVDADKAAREAVKKGSKGLAQVREVFGDEAIDENGEMNRRYMGDLVFNHPEKRLELNAIIHPIVRDIMEEEKQEYLKQGYNVIMDIPLLFENELENTVDEVWVVYTSESIQMDRLMQRNNLSLEDAKARVYSQISIDKKSRMADHVIDNLGDKLELKQNLERLLEEEGYIEKPNYGEED

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS08510 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]