From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS12810 [old locus tag: SA2231 ]
  • pan locus tag?: SAUPAN005993000
  • symbol: SA_RS12810
  • pan gene symbol?:
  • synonym:
  • product: NAD(P)-dependent oxidoreductase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS12810 [old locus tag: SA2231 ]
  • symbol: SA_RS12810
  • product: NAD(P)-dependent oxidoreductase
  • replicon: chromosome
  • strand: -
  • coordinates: 2505453..2506304
  • length: 852
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (2505453..2506304) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGAGTAAAATTTTTGTAACTGGTGCAACGGGCCTTATTGGCATTAAATTAGTTCAAAGA
    CTAAAAGAAGAGGGGCATGAGGTTGCTGGTTTTACTACATCTGAGAATGGTCAACAAAAG
    CTAGCTGCTATTAATGTAAAAGCATATATTGGTGATATATTAAAAGCTGATACTATTGAT
    CAAGCGTTAGCAGATTTTAAACCAGAAATCATTATCAACCAAATTACGGATTTAAAAAAT
    GTTGATATGGCAGCAAATACGAAAGTACGTATTGAAGGTTCTAAAAACTTAATTGATGCG
    GCGAAAAAGCATGACGTTAAGAAAGTAATTGCCCAAAGTATTGCCTTTATGTATGAACCT
    GGCGAAGGATTAGCAAATGAGGAAACTTCACTTGATTTTAACTCAACTGGTGATAGAAAA
    GTAACGGTTGATGGTGTGGTTGGTCTAGAAGAAGAAACGGCTCGTATGGATGAATACGTT
    GTTTTACGTTTTGGTTGGTTATATGGCCCAGGTACTTGGTACGGAAAAGATGGCATGATT
    TATAATCAATTTATGGATGGTCAAGTGACACTTTCAGATGGCGTAACATCATTTGTGCAT
    CTTGATGATGCAGTTGAAACATCTATTCAAGCTATTCATTTTGAAAATGGTATCTATAAT
    GTAGCAGATGATGCACCTGTTAAAGGTTCTGAATTTGCAGAATGGTATAAAGAACAACTT
    GGTGTTGAACCAAATATTGATATTCAACCTGCACAACCATTTGAACGTGGCGTAAGCAAT
    GAGAAGTTTAAAGCGCAAGGTGGTACTCTGATTTATAAAACTTGGAAAGACGGCATGAAT
    CCAATTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    852

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS12810 [old locus tag: SA2231 ]
  • symbol: SA_RS12810
  • description: NAD(P)-dependent oxidoreductase
  • length: 283
  • theoretical pI: 4.53054
  • theoretical MW: 31206
  • GRAVY: -0.301413

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    hopanoid-associated sugar epimerase (TIGR03466; HMM-score: 55.7)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesADP-glyceromanno-heptose 6-epimerase (TIGR02197; EC 5.1.3.20; HMM-score: 47.5)
    Hypothetical proteinsConservedTIGR01777 family protein (TIGR01777; HMM-score: 44.9)
    MetabolismEnergy metabolismSugarsUDP-glucose 4-epimerase GalE (TIGR01179; EC 5.1.3.2; HMM-score: 35.5)
    NAD dependent epimerase/dehydratase, LLPSF_EDH_00030 family (TIGR04180; HMM-score: 32.6)
    UDP-N-acetylglucosamine 4,6-dehydratase (inverting) (TIGR03589; EC 4.2.1.115; HMM-score: 32)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesdTDP-4-dehydrorhamnose reductase (TIGR01214; EC 1.1.1.133; HMM-score: 31.9)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesCDP-glucose 4,6-dehydratase (TIGR02622; EC 4.2.1.45; HMM-score: 29)
    MetabolismEnergy metabolismBiosynthesis and degradation of polysaccharidesbeta-phosphoglucomutase (TIGR01990; EC 5.4.2.6; HMM-score: 18.8)
    thioester reductase domain (TIGR01746; HMM-score: 18.4)
    lipid biosynthesis B12-binding/radical SAM protein (TIGR04072; HMM-score: 18)
    ergot alkaloid biosynthesis protein, AFUA_2G17970 family (TIGR03649; HMM-score: 17.4)
    acetoacetyl-CoA reductase (TIGR01829; EC 1.1.1.36; HMM-score: 16.9)
    Unknown functionEnzymes of unknown specificityputative quinone oxidoreductase, YhdH/YhfP family (TIGR02823; HMM-score: 15.8)
    2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (TIGR04316; EC 1.3.1.28; HMM-score: 14.8)
    2-hydroxycyclohexanecarboxyl-CoA dehydrogenase (TIGR03206; EC 1.1.1.-; HMM-score: 13.7)
    MetabolismFatty acid and phospholipid metabolismBiosynthesis3-oxoacyl-[acyl-carrier-protein] reductase (TIGR01830; EC 1.1.1.100; HMM-score: 13.4)
    3-hydroxybutyrate dehydrogenase (TIGR01963; HMM-score: 13.1)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) Epimerase; NAD dependent epimerase/dehydratase family (PF01370; HMM-score: 69.7)
    NAD_binding_10; NAD(P)H-binding (PF13460; HMM-score: 50.2)
    3Beta_HSD; 3-beta hydroxysteroid dehydrogenase/isomerase family (PF01073; HMM-score: 47.8)
    RmlD_sub_bind; RmlD substrate binding domain (PF04321; HMM-score: 40.6)
    Polysacc_synt_2; Polysaccharide biosynthesis protein (PF02719; HMM-score: 34)
    NmrA; NmrA-like family (PF05368; HMM-score: 27)
    GDP_Man_Dehyd; GDP-mannose 4,6 dehydratase (PF16363; HMM-score: 26.1)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 17.1)
    NAD_binding_2; NAD binding domain of 6-phosphogluconate dehydrogenase (PF03446; HMM-score: 17)
    adh_short; short chain dehydrogenase (PF00106; HMM-score: 16.6)
    Semialdhyde_dh; Semialdehyde dehydrogenase, NAD binding domain (PF01118; HMM-score: 16.4)
    DapB_N; Dihydrodipicolinate reductase, N-terminus (PF01113; HMM-score: 13.2)
    KR; KR domain (PF08659; HMM-score: 11.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.189
    • Ymax_pos: 26
    • Cmax: 0.138
    • Cmax_pos: 65
    • Smax: 0.432
    • Smax_pos: 21
    • Smean: 0.245
    • D: 0.211
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 445956642 NCBI
  • RefSeq: WP_000034497 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MSKIFVTGATGLIGIKLVQRLKEEGHEVAGFTTSENGQQKLAAINVKAYIGDILKADTIDQALADFKPEIIINQITDLKNVDMAANTKVRIEGSKNLIDAAKKHDVKKVIAQSIAFMYEPGEGLANEETSLDFNSTGDRKVTVDGVVGLEEETARMDEYVVLRFGWLYGPGTWYGKDGMIYNQFMDGQVTLSDGVTSFVHLDDAVETSIQAIHFENGIYNVADDAPVKGSEFAEWYKEQLGVEPNIDIQPAQPFERGVSNEKFKAQGGTLIYKTWKDGMNPIK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS12810 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]