Jump to navigation
Jump to search
NCBI: 22-FEB-2026
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_RS10020 [old locus tag: EGJ38_002007 ]
- pan locus tag?: SAUPAN005301000
- symbol: tsaE
- pan gene symbol?: tsaE
- synonym:
- product: tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_RS10020 [old locus tag: EGJ38_002007 ]
- symbol: tsaE
- product: tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
- replicon: chromosome
- strand: -
- coordinates: 2020603..2021064
- length: 462
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NZ_CM129921 (2020603..2021064) NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421TTGATAAAGATAAATAATTTAGATGAAATGAATCAATTTGCTATATTTTTAGTTGAGCAA
TTGAAAAGTGGTGATTTGATTTTACTTAACGGAGATTTAGGAGCAGGTAAAACAACGTTA
ACGCAATTTATAGGAAAAGCTCTTGGTGTAAGACGTACGATTAATTCCCCGACATTTAAC
ATCATTAAATCATATAGTGGTAAAAATTTAAAATTGCATCATATGGATTGTTATCGCTTA
GAAGATTCTGATGAAGATTTAGGGTTTGATGAATTTTTCGAAGATCAGGCAATTACTGTT
ATTGAATGGAGTCAATTTATAAAAGATTTACTTCCAGCGACGCATTTATCTATTAATATT
TCAACAATATCTGAAAATACAAGACAAATTGAGTTGTTCGCGCAAGGAGAACATTTTGAA
CAAATTAAGGAGGCAATTATTCATGAATTCGCTGCTCATTGA60
120
180
240
300
360
420
462
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_RS10020 [old locus tag: EGJ38_002007 ]
- symbol: TsaE
- description: tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
- length: 153
- theoretical pI: 4.69463
- theoretical MW: 17427.7
- GRAVY: -0.148366
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 128.5)and 8 moreABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 15.5)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 14.2)Protein fate Protein and peptide secretion and trafficking putative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 12.7)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 12.7)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 12.7)DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 12.2)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12.2)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12.2)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: P-loop_NTPase (CL0023) TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 130)and 14 moreAAA_18; AAA domain (PF13238; HMM-score: 17.1)RuvB_N; Holliday junction DNA helicase RuvB P-loop domain (PF05496; HMM-score: 16)AAA_23; AAA domain (PF13476; HMM-score: 15.6)NPHP3_N; Nephrocystin 3, N-terminal (PF24883; HMM-score: 14.6)NACHT; NACHT domain (PF05729; HMM-score: 14.2)ABC_tran; ABC transporter (PF00005; HMM-score: 13.9)AAA_16; AAA ATPase domain (PF13191; HMM-score: 13.2)dNK; Deoxynucleoside kinase (PF01712; HMM-score: 13)AAA_22; AAA domain (PF13401; HMM-score: 12.9)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 12.7)TIP49; TIP49 P-loop domain (PF06068; HMM-score: 12.3)TIM_barrel (CL0036) DUF561; Protein of unknown function (DUF561) (PF04481; HMM-score: 12.2)P-loop_NTPase (CL0023) Zeta_toxin; Zeta toxin (PF06414; HMM-score: 11.5)AAA_25; AAA domain (PF13481; HMM-score: 11.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9998
- Cytoplasmic Membrane Score: 0.0001
- Cell wall & surface Score: 0
- Extracellular Score: 0.0001
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.009881
- TAT(Tat/SPI): 0.002925
- LIPO(Sec/SPII): 0.000672
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_000590799 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MIKINNLDEMNQFAIFLVEQLKSGDLILLNGDLGAGKTTLTQFIGKALGVRRTINSPTFNIIKSYSGKNLKLHHMDCYRLEDSDEDLGFDEFFEDQAITVIEWSQFIKDLLPATHLSINISTISENTRQIELFAQGEHFEQIKEAIIHEFAAH
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]