Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL2041 [new locus tag: SACOL_RS10655 ]
- pan locus tag?: SAUPAN005301000
- symbol: SACOL2041
- pan gene symbol?: tsaE
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL2041 [new locus tag: SACOL_RS10655 ]
- symbol: SACOL2041
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 2100097..2100531
- length: 435
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3236693 NCBI
- RefSeq: YP_186858 NCBI
- BioCyc: see SACOL_RS10655
- MicrobesOnline: 913514 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421ATGAATCAATTTGCTATATTTTTAGTTGAGCAATTGAAAAGTGGTGATTTGATTTTACTT
AACGGAGATTTAGGAGCAGGTAAAACAACGTTAACGCAATTTATAGGAAAAGCTCTTGGT
GTAAGACGTACGATTAATTCCCCGACATTTAACATCATTAAATCATATAGGGGTAAAAAT
TTAAAATTGCATCATATGGATTGTTATCGCTTAGAAGATTCTGATGAAGATTTAGGATTT
GATGAATTTTTCGAAGATCAGGCAATTACTGTTATTGAATGGAGTCAATTTATAAAAGAT
TTACTTCCAGCGACGCATTTATCTATTAACATTTCAACAATATCTGAAAATACAAGACAA
ATTGAGTTGTTCGCGCAAGGAGAACATTATGAACAAATTAAGGAGGCAATTATCCATGAA
TTCGCTGCTCATTGA60
120
180
240
300
360
420
435
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL2041 [new locus tag: SACOL_RS10655 ]
- symbol: SACOL2041
- description: hypothetical protein
- length: 144
- theoretical pI: 4.97011
- theoretical MW: 16441.5
- GRAVY: -0.189583
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 125.6)and 9 moreABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 15.4)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 14.2)Protein fate Protein and peptide secretion and trafficking putative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 12.7)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 12.4)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 12.4)DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 12.2)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 10.7)
- TheSEED :
- tRNA threonylcarbamoyladenosine biosynthesis protein TsaE
Cell Wall and Capsule Cell Wall and Capsule - no subcategory YjeE TsaE protein, required for threonylcarbamoyladenosine t(6)A37 formation in tRNAand 2 more - PFAM: P-loop_NTPase (CL0023) TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 126.2)and 15 moreAAA_18; AAA domain (PF13238; HMM-score: 17.3)RuvB_N; Holliday junction DNA helicase RuvB P-loop domain (PF05496; HMM-score: 15.8)AAA_23; AAA domain (PF13476; HMM-score: 15.3)NPHP3_N; Nephrocystin 3, N-terminal (PF24883; HMM-score: 14.5)NACHT; NACHT domain (PF05729; HMM-score: 14.4)ABC_tran; ABC transporter (PF00005; HMM-score: 13.8)dNK; Deoxynucleoside kinase (PF01712; HMM-score: 13.4)AAA_16; AAA ATPase domain (PF13191; HMM-score: 12.8)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 12.7)AAA_22; AAA domain (PF13401; HMM-score: 12.7)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 12.7)TIM_barrel (CL0036) DUF561; Protein of unknown function (DUF561) (PF04481; HMM-score: 12.1)P-loop_NTPase (CL0023) TIP49; TIP49 P-loop domain (PF06068; HMM-score: 12)Zeta_toxin; Zeta toxin (PF06414; HMM-score: 11.4)AAA_25; AAA domain (PF13481; HMM-score: 11.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9998
- Cytoplasmic Membrane Score: 0.0001
- Cell wall & surface Score: 0
- Extracellular Score: 0.0001
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.010491
- TAT(Tat/SPI): 0.001918
- LIPO(Sec/SPII): 0.002381
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MNQFAIFLVEQLKSGDLILLNGDLGAGKTTLTQFIGKALGVRRTINSPTFNIIKSYRGKNLKLHHMDCYRLEDSDEDLGFDEFFEDQAITVIEWSQFIKDLLPATHLSINISTISENTRQIELFAQGEHYEQIKEAIIHEFAAH
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2] [3] [4]
- quantitative data / protein copy number per cell: 34 [5]
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
J Proteome Res: 2010, 9(3);1579-90
[PubMed:20108986] [WorldCat.org] [DOI] (I p) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e)