From AureoWiki
(Redirected from JSNZ 002007)
Jump to navigation Jump to search

NCBI: 01-DEC-2025

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: EGJ38_002007 [new locus tag: EGJ38_RS10020 ]
  • pan locus tag?: SAUPAN005301000
  • symbol: tsaE
  • pan gene symbol?: tsaE
  • synonym:
  • alternate name: JSNZ_002007
  • product: tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: EGJ38_002007 [new locus tag: EGJ38_RS10020 ]
  • symbol: tsaE
  • product: tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
  • replicon: chromosome
  • strand: -
  • coordinates: 2020603..2021064
  • length: 462
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq: MGT2423913 NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    TTGATAAAGATAAATAATTTAGATGAAATGAATCAATTTGCTATATTTTTAGTTGAGCAA
    TTGAAAAGTGGTGATTTGATTTTACTTAACGGAGATTTAGGAGCAGGTAAAACAACGTTA
    ACGCAATTTATAGGAAAAGCTCTTGGTGTAAGACGTACGATTAATTCCCCGACATTTAAC
    ATCATTAAATCATATAGTGGTAAAAATTTAAAATTGCATCATATGGATTGTTATCGCTTA
    GAAGATTCTGATGAAGATTTAGGGTTTGATGAATTTTTCGAAGATCAGGCAATTACTGTT
    ATTGAATGGAGTCAATTTATAAAAGATTTACTTCCAGCGACGCATTTATCTATTAATATT
    TCAACAATATCTGAAAATACAAGACAAATTGAGTTGTTCGCGCAAGGAGAACATTTTGAA
    CAAATTAAGGAGGCAATTATTCATGAATTCGCTGCTCATTGA
    60
    120
    180
    240
    300
    360
    420
    462

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: EGJ38_002007 [new locus tag: EGJ38_RS10020 ]
  • symbol: TsaE
  • description: tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
  • length: 153
  • theoretical pI: 4.69463
  • theoretical MW: 17427.7
  • GRAVY: -0.148366

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 128.5)
    and 8 more
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 15.5)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 14.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking putative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 12.7)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 12.7)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 12.7)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 12.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12.2)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12.2)
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    P-loop_NTPase (CL0023) TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 130)
    and 14 more
    AAA_18; AAA domain (PF13238; HMM-score: 17.1)
    RuvB_N; Holliday junction DNA helicase RuvB P-loop domain (PF05496; HMM-score: 16)
    AAA_23; AAA domain (PF13476; HMM-score: 15.6)
    NPHP3_N; Nephrocystin 3, N-terminal (PF24883; HMM-score: 14.6)
    NACHT; NACHT domain (PF05729; HMM-score: 14.2)
    ABC_tran; ABC transporter (PF00005; HMM-score: 13.9)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 13.2)
    dNK; Deoxynucleoside kinase (PF01712; HMM-score: 13)
    AAA_22; AAA domain (PF13401; HMM-score: 12.9)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 12.7)
    TIP49; TIP49 P-loop domain (PF06068; HMM-score: 12.3)
    TIM_barrel (CL0036) DUF561; Protein of unknown function (DUF561) (PF04481; HMM-score: 12.2)
    P-loop_NTPase (CL0023) Zeta_toxin; Zeta toxin (PF06414; HMM-score: 11.5)
    AAA_25; AAA domain (PF13481; HMM-score: 11.1)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9998
    • Cytoplasmic Membrane Score: 0.0001
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0001
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.009881
    • TAT(Tat/SPI): 0.002925
    • LIPO(Sec/SPII): 0.000672
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: MGT2423913 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MIKINNLDEMNQFAIFLVEQLKSGDLILLNGDLGAGKTTLTQFIGKALGVRRTINSPTFNIIKSYSGKNLKLHHMDCYRLEDSDEDLGFDEFFEDQAITVIEWSQFIKDLLPATHLSINISTISENTRQIELFAQGEHFEQIKEAIIHEFAAH

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
    Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
    Bioinformatics: 2018, 34(23);4118-4120
    [PubMed:29931111] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]