From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1704 [new locus tag: NWMN_RS09575 ]
  • pan locus tag?: SAUPAN004564000
  • symbol: splC
  • pan gene symbol?: splC
  • synonym:
  • product: serine protease SplC

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_1704 [new locus tag: NWMN_RS09575 ]
  • symbol: splC
  • product: serine protease SplC
  • replicon: chromosome
  • strand: -
  • coordinates: 1901869..1902588
  • length: 720
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGAATAAAAATATAGTCATTAAAAGCATGGCAGCATTAGCCATTCTAACCTCAGTAACT
    GGAATAAATGCTGCAGTCGTTGAAGAGACACAACAAATAGCAAATGCAGAGAAGAATGTT
    ACGCAAGTTAAAGATACAAATATTTTTCCATATAATGGCGTCGTTTCATTTAAAGATGCG
    ACAGGTTTTGTAATTGGAAAAAATACAATTATCACCAATAAACATGTATCAAAAGATTAT
    AAAGTTGGCGATAGAATTACTGCCCATCCAAACGGTGACAAAGGAAATGGTGGTATATAT
    AAAATTAAAAGCATTTCTGATTATCCGGGTGATGAAGACATCTCTGTCATGAATATTGAA
    GAACAAGCAGTCGAACGTGGACCAAAAGGCTTTAATTTTAATGAAAATGTCCAAGCATTC
    AATTTTGCGAAAGATGCTAAAGTTGATGACAAAATTAAAGTTATTGGTTACCCATTACCT
    GCTCAAAATAGTTTTAAACAGTTTGAATCTACAGGAACTATAAAAAGAATCAAAGACAAT
    ATTTTAAATTTTGATGCATACATTGAACCCGGGAATTCAGGATCACCAGTTCTAAATTCT
    AACAATGAGGTCATAGGTGTGGTGTATGGCGGTATTGGAAAAATTGGTTCTGAATATAAT
    GGTGCCGTATACTTTACGCCTCAAATCAAAGATTTTATTCAAAAGCACATTGAACAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720

Protein[edit | edit source]

Protein Data Bank: 2AS9

General[edit | edit source]

  • locus tag: NWMN_1704 [new locus tag: NWMN_RS09575 ]
  • symbol: SplC
  • description: serine protease SplC
  • length: 239
  • theoretical pI: 6.81386
  • theoretical MW: 26098.2
  • GRAVY: -0.348117

Function[edit | edit source]

  • reaction:
    EC 3.4.21.-?  ExPASy
  • TIGRFAM:
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides periplasmic serine peptidase DegS (TIGR02038; EC 3.4.21.-; HMM-score: 18.1)
    Signal transduction Regulatory functions Protein interactions periplasmic serine peptidase DegS (TIGR02038; EC 3.4.21.-; HMM-score: 18.1)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides peptidase Do (TIGR02037; EC 3.4.21.-; HMM-score: 15.2)
    Genetic information processing Protein fate Protein folding and stabilization peptidase Do (TIGR02037; EC 3.4.21.-; HMM-score: 15.2)
  • TheSEED:  
    serine protease
  • PFAM:
    Peptidase_PA (CL0124) Trypsin; Trypsin (PF00089; HMM-score: 85.7)
    and 6 more
    Trypsin_2; Trypsin-like peptidase domain (PF13365; HMM-score: 53.1)
    Peptidase_S46; Peptidase S46 (PF10459; HMM-score: 19.9)
    Peptidase_S7; Peptidase S7, Flavivirus NS3 serine protease (PF00949; HMM-score: 19.4)
    DUF31; Putative peptidase (DUF31) (PF01732; HMM-score: 14.6)
    Peptidase_S32; Equine arteritis virus serine endopeptidase S32 (PF05579; HMM-score: 13.4)
    no clan defined DUF3836; Family of unknown function (DUF3836) (PF12930; HMM-score: 12.4)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.18
    • Extracellular Score: 9.73
    • Internal Helices: 0
  • LocateP: Secretory(released) (with CS)
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: -0.17
    • Signal peptide possibility: 1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: AVVEETQQ
  • SignalP: Signal peptide SP(Sec/SPI) length 36 aa
    • SP(Sec/SPI): 0.980234
    • TAT(Tat/SPI): 0.004245
    • LIPO(Sec/SPII): 0.00665
    • Cleavage Site: CS pos: 36-37. ANA-EK. Pr: 0.5178
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MNKNIVIKSMAALAILTSVTGINAAVVEETQQIANAEKNVTQVKDTNIFPYNGVVSFKDATGFVIGKNTIITNKHVSKDYKVGDRITAHPNGDKGNGGIYKIKSISDYPGDEDISVMNIEEQAVERGPKGFNFNENVQAFNFAKDAKVDDKIKVIGYPLPAQNSFKQFESTGTIKRIKDNILNFDAYIEPGNSGSPVLNSNNEVIGVVYGGIGKIGSEYNGAVYFTPQIKDFIQKHIEQ

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]