From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS02410 [old locus tag: NWMN_0426 ]
  • pan locus tag?: SAUPAN002176000
  • symbol: NWMN_RS02410
  • pan gene symbol?: metN2
  • synonym:
  • product: ABC transporter ATP-binding protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_RS02410 [old locus tag: NWMN_0426 ]
  • symbol: NWMN_RS02410
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: +
  • coordinates: 478435..479400
  • length: 966
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Location: NC_009641 (478435..479400) NCBI
  • BioCyc:
  • MicrobesOnline: see NWMN_0426

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    TTGAAGGACGTATCATTTACGGTCAATCGCAATGATATTTTTGGTGTGATTGGATATAGT
    GGTGCAGGAAAAAGTACGTTGGTAAGACTCGTGAATCATCTTGAAGCTGCCTCGAATGGA
    CAAGTGATTGTAGATGGACATGATATTACGAATTATAGCGATAAAATGATGAGGGATATT
    AAGAAAGATATCGGTATGATATTTCAGCATTTCAATTTATTAAATTCAGCTACCGTATTT
    AAAAATGTAGCAATGCCACTCATTTTAAGTAAGAAAAGCAAAACAGAAATTAAGCAACGA
    GTAACGGAAATGCTTGAATTTGTAGGATTGAGTGATAAAAAAGACCAATTTCCTGATGAA
    TTATCTGGTGGGCAGAAGCAAAGGGTGGCTATTGCAAGAGCGCTTGTTACTAATCCGAAA
    ATACTCCTATGCGATGAAGCAACAAGCGCATTGGATCCAGCAACGACTGCTTCGATATTG
    ACGTTATTAAAGAATGTCAATCAAACCTTTGGCATTACAATTATGATGATTACACATGAA
    ATGCGCGTTATTAAAGACATTTGTAATCGTGTTGCTGTAATGGAAAAGGGGAAAGTGGTT
    GAAACAGGAACTGTTAAAGAGGTGTTTAGTCATCCTAAAACGACGATTGCTCAAAATTTT
    GTGTCTACAGTTATACAGACTGAGCCAAGTACATCATTGATTCGTCGATTGAATGACGAA
    CAAGTTGGCGATTTTAAAGATTATAAAATCTTCGTCGAGGAAACTCAGGTGACACAACCG
    ATTATAAATGACTTGATTCAAATTTGTGGCAGAGAGGTTAAAATTTTATTTTCATCTATG
    TCAGAAATACAAGGTAACACCGTATGTTATATGTGGCTTCGATTTAATATGGATCAACAA
    TTTGAAGACACGGCAATAAATCAATATTTCAAAGAGAAAAATATTCAATTTGAGGAGGTG
    CATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    966

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_RS02410 [old locus tag: NWMN_0426 ]
  • symbol: NWMN_RS02410
  • description: ABC transporter ATP-binding protein
  • length: 321
  • theoretical pI: 6.7909
  • theoretical MW: 36271.6
  • GRAVY: -0.153271

Function[edit | edit source]

  • reaction:
    EC 3.6.3.-?  ExPASy
  • TIGRFAM:
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 355.3)
    and 70 more
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 211.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 208.3)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 203.2)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 202.3)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 200.3)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 195.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 190.6)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 190.2)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 189.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 188.9)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 186.1)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 184.7)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 180.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 178.7)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 170)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 169.2)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 169.2)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 163.6)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 153.2)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 152.2)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 147.5)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 142.4)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 142.1)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 136)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 136)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 134.9)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 134.9)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 133.9)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 132.9)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 132.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 132.4)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 131.4)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 127.2)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 127.2)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 125.6)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 125.6)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 125.2)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 123.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 121.9)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 121.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 121.7)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 120)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 109.9)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 109.9)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 108.6)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 108.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 105.8)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 104.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 103.5)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 103.5)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 103.5)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 102.9)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 99.1)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 94.9)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 93.4)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 92.5)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 91)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 88.8)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 82.7)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 82.3)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 82.3)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 76)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 71.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 65.4)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 57.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 54.7)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 54.7)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 49.4)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 41.9)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 30.5)
  • TheSEED: data available for COL, N315, NCTC8325, USA300_FPR3757
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 122.1)
    and 17 more
    ACT (CL0070) NIL; NIL domain (PF09383; HMM-score: 40.3)
    P-loop_NTPase (CL0023) AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 26.4)
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 25.5)
    AAA_22; AAA domain (PF13401; HMM-score: 21.6)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 20.6)
    no clan defined DUF3652; Huntingtin protein region (PF12372; HMM-score: 16.8)
    P-loop_NTPase (CL0023) AAA_30; AAA domain (PF13604; HMM-score: 16.3)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 15.6)
    AAA_18; AAA domain (PF13238; HMM-score: 14.8)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 14.7)
    AAA_23; AAA domain (PF13476; HMM-score: 14)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 13.6)
    no clan defined DUF99; Protein of unknown function DUF99 (PF01949; HMM-score: 13.4)
    P-loop_NTPase (CL0023) SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 13.3)
    AAA_17; AAA domain (PF13207; HMM-score: 13.2)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 12.8)
    AAA_33; AAA domain (PF13671; HMM-score: 12.6)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.028736
    • TAT(Tat/SPI): 0.009217
    • LIPO(Sec/SPII): 0.003041
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKDVSFTVNRNDIFGVIGYSGAGKSTLVRLVNHLEAASNGQVIVDGHDITNYSDKMMRDIKKDIGMIFQHFNLLNSATVFKNVAMPLILSKKSKTEIKQRVTEMLEFVGLSDKKDQFPDELSGGQKQRVAIARALVTNPKILLCDEATSALDPATTASILTLLKNVNQTFGITIMMITHEMRVIKDICNRVAVMEKGKVVETGTVKEVFSHPKTTIAQNFVSTVIQTEPSTSLIRRLNDEQVGDFKDYKIFVEETQVTQPIINDLIQICGREVKILFSSMSEIQGNTVCYMWLRFNMDQQFEDTAINQYFKEKNIQFEEVH

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:
    NWMN_RS10565(gatA)glutamyl-tRNA(Gln) amidotransferase subunit A  [1] (data from MRSA252)
    NWMN_RS00010DNA polymerase III subunit beta  [1] (data from MRSA252)
    NWMN_RS02960elongation factor G  [1] (data from MRSA252)
    NWMN_RS02965elongation factor Tu  [1] (data from MRSA252)
    NWMN_RS04590NADH dehydrogenase  [1] (data from MRSA252)
    NWMN_RS04730hypothetical protein  [1] (data from MRSA252)
    NWMN_RS05390dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    NWMN_RS06295carbamoyl-phosphate synthase large chain  [1] (data from MRSA252)
    NWMN_RS0657530S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_RS08080acetyl-CoA carboxylase biotin carboxylase subunit  [1] (data from MRSA252)
    NWMN_RS08345molecular chaperone DnaJ  [1] (data from MRSA252)
    NWMN_RS08865aldehyde dehydrogenase  [1] (data from MRSA252)
    NWMN_RS08905isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    NWMN_RS08930pyruvate kinase  [1] (data from MRSA252)
    NWMN_RS08995universal stress protein UspA  [1] (data from MRSA252)
    NWMN_RS09425S-adenosylmethionine synthase  [1] (data from MRSA252)
    NWMN_RS10560aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B  [1] (data from MRSA252)
    NWMN_RS11875glutamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    NWMN_RS1234030S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_RS1236550S ribosomal protein L5  [1] (data from MRSA252)
    NWMN_RS1239530S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_RS14060hydroxymethylglutaryl-CoA synthase  [1] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]