Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_RS02410 [old locus tag: NWMN_0426 ]
- pan locus tag?: SAUPAN002176000
- symbol: NWMN_RS02410
- pan gene symbol?: gmpA
- synonym:
- product: ABC transporter ATP-binding protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_RS02410 [old locus tag: NWMN_0426 ]
- symbol: NWMN_RS02410
- product: ABC transporter ATP-binding protein
- replicon: chromosome
- strand: +
- coordinates: 478435..479400
- length: 966
- essential: unknown
⊟Accession numbers[edit | edit source]
- Location: NC_009641 (478435..479400) NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961TTGAAGGACGTATCATTTACGGTCAATCGCAATGATATTTTTGGTGTGATTGGATATAGT
GGTGCAGGAAAAAGTACGTTGGTAAGACTCGTGAATCATCTTGAAGCTGCCTCGAATGGA
CAAGTGATTGTAGATGGACATGATATTACGAATTATAGCGATAAAATGATGAGGGATATT
AAGAAAGATATCGGTATGATATTTCAGCATTTCAATTTATTAAATTCAGCTACCGTATTT
AAAAATGTAGCAATGCCACTCATTTTAAGTAAGAAAAGCAAAACAGAAATTAAGCAACGA
GTAACGGAAATGCTTGAATTTGTAGGATTGAGTGATAAAAAAGACCAATTTCCTGATGAA
TTATCTGGTGGGCAGAAGCAAAGGGTGGCTATTGCAAGAGCGCTTGTTACTAATCCGAAA
ATACTCCTATGCGATGAAGCAACAAGCGCATTGGATCCAGCAACGACTGCTTCGATATTG
ACGTTATTAAAGAATGTCAATCAAACCTTTGGCATTACAATTATGATGATTACACATGAA
ATGCGCGTTATTAAAGACATTTGTAATCGTGTTGCTGTAATGGAAAAGGGGAAAGTGGTT
GAAACAGGAACTGTTAAAGAGGTGTTTAGTCATCCTAAAACGACGATTGCTCAAAATTTT
GTGTCTACAGTTATACAGACTGAGCCAAGTACATCATTGATTCGTCGATTGAATGACGAA
CAAGTTGGCGATTTTAAAGATTATAAAATCTTCGTCGAGGAAACTCAGGTGACACAACCG
ATTATAAATGACTTGATTCAAATTTGTGGCAGAGAGGTTAAAATTTTATTTTCATCTATG
TCAGAAATACAAGGTAACACCGTATGTTATATGTGGCTTCGATTTAATATGGATCAACAA
TTTGAAGACACGGCAATAAATCAATATTTCAAAGAGAAAAATATTCAATTTGAGGAGGTG
CATTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
966
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_RS02410 [old locus tag: NWMN_0426 ]
- symbol: NWMN_RS02410
- description: ABC transporter ATP-binding protein
- length: 321
- theoretical pI: 6.7909
- theoretical MW: 36271.6
- GRAVY: -0.153271
⊟Function[edit | edit source]
- reaction: EC 3.6.3.-? ExPASy
- TIGRFAM: D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 355.3)and 70 moreCellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 211.8)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 208.3)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 203.2)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 202.3)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 200.3)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 195.3)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 190.6)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 190.2)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 189.2)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 188.9)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 186.1)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 184.7)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 180.8)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 178.7)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 170)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 169.2)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 169.2)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 163.6)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 153.2)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 152.2)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 147.5)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 142.4)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 142.1)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 136)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 136)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 134.9)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 134.9)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 133.9)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 132.9)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 132.9)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 132.4)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 131.4)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 127.2)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 127.2)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 125.6)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 125.6)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 125.2)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 123.8)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 121.9)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 121.7)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 121.7)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 120)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 109.9)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 109.9)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 108.6)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 108.3)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 105.8)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 104.6)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 103.5)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 103.5)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 103.5)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 102.9)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 99.1)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 94.9)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 93.4)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 92.5)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 91)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 88.8)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 82.7)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 82.3)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 82.3)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 76)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 71.1)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 65.4)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 57.7)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 54.7)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 54.7)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 49.4)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 41.9)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 30.5)
- TheSEED:
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 122.1)and 17 moreACT (CL0070) NIL; NIL domain (PF09383; HMM-score: 40.3)P-loop_NTPase (CL0023) AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 26.4)SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 25.5)AAA_22; AAA domain (PF13401; HMM-score: 21.6)AAA_16; AAA ATPase domain (PF13191; HMM-score: 20.6)no clan defined DUF3652; Huntingtin protein region (PF12372; HMM-score: 16.8)P-loop_NTPase (CL0023) AAA_30; AAA domain (PF13604; HMM-score: 16.3)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 15.6)AAA_18; AAA domain (PF13238; HMM-score: 14.8)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 14.7)AAA_23; AAA domain (PF13476; HMM-score: 14)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 13.6)no clan defined DUF99; Protein of unknown function DUF99 (PF01949; HMM-score: 13.4)P-loop_NTPase (CL0023) SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 13.3)AAA_17; AAA domain (PF13207; HMM-score: 13.2)MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 12.8)AAA_33; AAA domain (PF13671; HMM-score: 12.6)
⊟Structure, modifications & interactions[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
- protein partners:
NWMN_RS10565 (gatA) glutamyl-tRNA(Gln) amidotransferase subunit A [1] (data from MRSA252) NWMN_RS00010 DNA polymerase III subunit beta [1] (data from MRSA252) NWMN_RS02960 elongation factor G [1] (data from MRSA252) NWMN_RS02965 elongation factor Tu [1] (data from MRSA252) NWMN_RS04590 NADH dehydrogenase [1] (data from MRSA252) NWMN_RS04730 hypothetical protein [1] (data from MRSA252) NWMN_RS05390 dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex [1] (data from MRSA252) NWMN_RS06295 carbamoyl-phosphate synthase large chain [1] (data from MRSA252) NWMN_RS06575 30S ribosomal protein S2 [1] (data from MRSA252) NWMN_RS08080 acetyl-CoA carboxylase biotin carboxylase subunit [1] (data from MRSA252) NWMN_RS08345 molecular chaperone DnaJ [1] (data from MRSA252) NWMN_RS08865 aldehyde dehydrogenase [1] (data from MRSA252) NWMN_RS08905 isocitrate dehydrogenase (NADP(+)) [1] (data from MRSA252) NWMN_RS08930 pyruvate kinase [1] (data from MRSA252) NWMN_RS08995 universal stress protein UspA [1] (data from MRSA252) NWMN_RS09425 S-adenosylmethionine synthase [1] (data from MRSA252) NWMN_RS10560 aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B [1] (data from MRSA252) NWMN_RS11875 glutamine--fructose-6-phosphate aminotransferase [1] (data from MRSA252) NWMN_RS12340 30S ribosomal protein S5 [1] (data from MRSA252) NWMN_RS12365 50S ribosomal protein L5 [1] (data from MRSA252) NWMN_RS12395 30S ribosomal protein S3 [1] (data from MRSA252) NWMN_RS14060 hydroxymethylglutaryl-CoA synthase [1] (data from MRSA252)
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 1.05
- Cytoplasmic Membrane Score: 8.78
- Cellwall Score: 0.08
- Extracellular Score: 0.09
- Internal Helices: 0
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.028736
- TAT(Tat/SPI): 0.009217
- LIPO(Sec/SPII): 0.003041
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_001790880 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MKDVSFTVNRNDIFGVIGYSGAGKSTLVRLVNHLEAASNGQVIVDGHDITNYSDKMMRDIKKDIGMIFQHFNLLNSATVFKNVAMPLILSKKSKTEIKQRVTEMLEFVGLSDKKDQFPDELSGGQKQRVAIARALVTNPKILLCDEATSALDPATTASILTLLKNVNQTFGITIMMITHEMRVIKDICNRVAVMEKGKVVETGTVKEVFSHPKTTIAQNFVSTVIQTEPSTSLIRRLNDEQVGDFKDYKIFVEETQVTQPIINDLIQICGREVKILFSSMSEIQGNTVCYMWLRFNMDQQFEDTAINQYFKEKNIQFEEVH
⊟Experimental data[edit | edit source]
- experimentally validated: no data available
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)
⊟Relevant publications[edit | edit source]