Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_RS11300 [old locus tag: NWMN_1959 ]
- pan locus tag?: SAUPAN005301000
- symbol: NWMN_RS11300
- pan gene symbol?: tsaE
- synonym:
- product: tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_RS11300 [old locus tag: NWMN_1959 ]
- symbol: NWMN_RS11300
- product: tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
- replicon: chromosome
- strand: -
- coordinates: 2168480..2168914
- length: 435
- essential: unknown
⊟Accession numbers[edit | edit source]
- Location: NC_009641 (2168480..2168914) NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421ATGAATCAATTTGCTATATTTTTAGTTGAGCAATTGAAAAGTGGTGATTTGATTTTACTT
AACGGAGATTTAGGAGCAGGTAAAACAACGTTAACGCAATTTATAGGAAAAGCTCTTGGT
GTAAGACGTACGATTAATTCCCCGACATTTAACATCATTAAATCATATAGGGGTAAAAAT
TTAAAATTGCATCATATGGATTGTTATCGCTTAGAAGATTCTGATGAAGATTTAGGATTT
GATGAATTTTTCGAAGATCAGGCAATTACTGTTATTGAATGGAGTCAATTTATAAAAGAT
TTACTTCCAGCGACGCATTTATCTATTAACATTTCAACAATATCTGAAAATACAAGACAA
ATTGAGTTGTTCGCGCAAGGAGAACATTATGAACAAATTAAGGAGGCAATTATCCATGAA
TTCGCTGCTCATTGA60
120
180
240
300
360
420
435
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_RS11300 [old locus tag: NWMN_1959 ]
- symbol: NWMN_RS11300
- description: tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
- length: 144
- theoretical pI: 4.97011
- theoretical MW: 16441.5
- GRAVY: -0.189583
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 125.6)and 9 moreABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 15.4)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 14.2)Protein fate Protein and peptide secretion and trafficking putative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 12.7)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 12.4)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 12.4)DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 12.2)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 10.7)
- TheSEED:
- PFAM: P-loop_NTPase (CL0023) TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 119.5)and 12 moreAAA_18; AAA domain (PF13238; HMM-score: 21.9)NACHT; NACHT domain (PF05729; HMM-score: 16.5)RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 14.9)AAA_23; AAA domain (PF13476; HMM-score: 14.9)dNK; Deoxynucleoside kinase (PF01712; HMM-score: 14.8)ABC_tran; ABC transporter (PF00005; HMM-score: 13.4)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 13)AAA_22; AAA domain (PF13401; HMM-score: 12.7)AAA_33; AAA domain (PF13671; HMM-score: 12.7)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 12.5)TIM_barrel (CL0036) DUF561; Protein of unknown function (DUF561) (PF04481; HMM-score: 12.2)P-loop_NTPase (CL0023) Zeta_toxin; Zeta toxin (PF06414; HMM-score: 12.1)
⊟Structure, modifications & interactions[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
- protein partners:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.010491
- TAT(Tat/SPI): 0.001918
- LIPO(Sec/SPII): 0.002381
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_010956572 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MNQFAIFLVEQLKSGDLILLNGDLGAGKTTLTQFIGKALGVRRTINSPTFNIIKSYRGKNLKLHHMDCYRLEDSDEDLGFDEFFEDQAITVIEWSQFIKDLLPATHLSINISTISENTRQIELFAQGEHYEQIKEAIIHEFAAH
⊟Experimental data[edit | edit source]
- experimentally validated: no data available
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
⊟Relevant publications[edit | edit source]