Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_RS12300 [old locus tag: NWMN_2127 ]
- pan locus tag?: SAUPAN005677000
- symbol: NWMN_RS12300
- pan gene symbol?: rpsK
- synonym:
- product: 30S ribosomal protein S11
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_RS12300 [old locus tag: NWMN_2127 ]
- symbol: NWMN_RS12300
- product: 30S ribosomal protein S11
- replicon: chromosome
- strand: -
- coordinates: 2363357..2363746
- length: 390
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGGCACGTAAACAAGTATCTCGTAAACGTAGAGTGAAAAAGAATATTGAAAATGGTGTA
GCACACATCCGTTCAACATTCAACAACACTATTGTAACTATCACTGATGAGTTCGGTAAT
GCTTTATCATGGTCATCAGCTGGTGCATTAGGATTCAAAGGATCTAAAAAATCAACACCA
TTTGCAGCACAAATGGCTTCTGAAACTGCATCTAAATCAGCTATGGAGCATGGTTTAAAA
ACAGTTGAAGTAACAGTTAAAGGACCTGGTCCAGGTCGTGAATCAGCTATTCGTGCATTA
CAATCTGCAGGTTTAGAAGTAACTGCGATCAGAGACGTTACTCCAGTACCTCATAACGGT
TGTCGTCCACCAAAACGTCGTCGTGTATAA60
120
180
240
300
360
390
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_RS12300 [old locus tag: NWMN_2127 ]
- symbol: NWMN_RS12300
- description: 30S ribosomal protein S11
- length: 129
- theoretical pI: 11.8008
- theoretical MW: 13881.8
- GRAVY: -0.510078
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein uS11 (TIGR03632; HMM-score: 197.1)and 1 moreProtein synthesis Ribosomal proteins: synthesis and modification ribosomal protein uS11 (TIGR03628; HMM-score: 90.5)
- TheSEED: see NWMN_2127
- PFAM: S11_L18p (CL0267) Ribosomal_S11; Ribosomal protein S11 (PF00411; HMM-score: 172.4)and 1 moreno clan defined DUF7302; Family of unknown function (DUF7302) (PF23976; HMM-score: 13.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 10
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9194
- Cytoplasmic Membrane Score: 0.0069
- Cell wall & surface Score: 0.0008
- Extracellular Score: 0.0728
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.045703
- TAT(Tat/SPI): 0.006344
- LIPO(Sec/SPII): 0.001844
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MARKQVSRKRRVKKNIENGVAHIRSTFNNTIVTITDEFGNALSWSSAGALGFKGSKKSTPFAAQMASETASKSAMEHGLKTVEVTVKGPGPGRESAIRALQSAGLEVTAIRDVTPVPHNGCRPPKRRRV
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
NWMN_RS00885 formate acetyltransferase [1] (data from MRSA252) NWMN_RS01375 5'-nucleotidase, lipoprotein e(P4) family [1] (data from MRSA252) NWMN_RS02620 pur operon repressor [1] (data from MRSA252) NWMN_RS02690 RNA-binding protein S1 [1] (data from MRSA252) NWMN_RS02920 50S ribosomal protein L10 [1] (data from MRSA252) NWMN_RS02950 30S ribosomal protein S12 [1] (data from MRSA252) NWMN_RS02955 30S ribosomal protein S7 [1] (data from MRSA252) NWMN_RS03635 hypothetical protein [1] (data from MRSA252) NWMN_RS03640 LysR family transcriptional regulator [1] (data from MRSA252) NWMN_RS03695 hypothetical protein [1] (data from MRSA252) NWMN_RS03830 hypothetical protein [1] (data from MRSA252) NWMN_RS04215 enolase [1] (data from MRSA252) NWMN_RS05320 phosphocarrier protein HPr [1] (data from MRSA252) NWMN_RS05355 ribonuclease J 1 [1] (data from MRSA252) NWMN_RS05395 dihydrolipoyl dehydrogenase [1] (data from MRSA252) NWMN_RS06205 cell division protein FtsA [1] (data from MRSA252) NWMN_RS06435 beta-ketoacyl-ACP reductase [1] (data from MRSA252) NWMN_RS06490 50S ribosomal protein L19 [1] (data from MRSA252) NWMN_RS06675 ribonuclease J 2 [1] (data from MRSA252) NWMN_RS08350 molecular chaperone DnaK [1] (data from MRSA252) NWMN_RS08830 translation initiation factor IF-3 [1] (data from MRSA252) NWMN_RS08905 isocitrate dehydrogenase (NADP(+)) [1] (data from MRSA252) NWMN_RS08930 pyruvate kinase [1] (data from MRSA252) NWMN_RS08970 universal stress protein [1] (data from MRSA252) NWMN_RS09045 30S ribosomal protein S4 [1] (data from MRSA252) NWMN_RS09095 serine protease [1] (data from MRSA252) NWMN_RS09165 hypothetical protein [1] (data from MRSA252) NWMN_RS09195 thiol reductase thioredoxin [1] (data from MRSA252) NWMN_RS11175 molecular chaperone GroEL [1] (data from MRSA252) NWMN_RS12260 30S ribosomal protein S9 [1] (data from MRSA252) NWMN_RS12340 30S ribosomal protein S5 [1] (data from MRSA252) NWMN_RS12380 30S ribosomal protein S17 [1] (data from MRSA252) NWMN_RS12390 50S ribosomal protein L16 [1] (data from MRSA252) NWMN_RS12395 30S ribosomal protein S3 [1] (data from MRSA252) NWMN_RS12415 50S ribosomal protein L23 [1] (data from MRSA252) NWMN_RS12420 50S ribosomal protein L4 [1] (data from MRSA252) NWMN_RS12430 30S ribosomal protein S10 [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)