Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA2021 [new locus tag: SA_RS11625 ]
- pan locus tag?: SAUPAN005672000
- symbol: cbiO
- pan gene symbol?: cbiO1
- synonym: ecfA1
- product: cobalt transporter ATP-binding subunit
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA2021 [new locus tag: SA_RS11625 ]
- symbol: cbiO
- product: cobalt transporter ATP-binding subunit
- replicon: chromosome
- strand: -
- coordinates: 2293379..2294188
- length: 810
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1124940 NCBI
- RefSeq: NP_375335 NCBI
- BioCyc: see SA_RS11625
- MicrobesOnline: 104361 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781GTGGAGGATAAGAATTCAGTTATTGTATTTAAAAATGTTTCATTTCAATATCAAAGTGAT
GCATCCTTCACATTGAAAGATGTTTCTTTTAATATACCTAAAGGTCAGTGGACATCTATT
GTTGGTCATAACGGTTCTGGAAAATCTACAATTGCCAAGTTAATGATTGGCATAGAGAAA
GTTAAATCTGGAGAAATTTTTTATAATAATCAAGCTATAACTGATGATAATTTTGAAAAG
TTAAGAAAAGACATAGGAATTGTATTTCAGAATCCGGATAATCAATTTGTTGGTTCAATT
GTAAAATACGATGTAGCATTTGGACTCGAAAATCATGCGGTTCCACATGACGAAATGCAT
AGAAGAGTCAGCGAAGCACTTAAACAAGTTGATATGTTAGAACGTGCAGATTATGAACCT
AATGCATTATCGGGGGGACAGAAGCAGCGTGTGGCTATAGCAAGTGTATTAGCACTTAAC
CCCTCTGTCATTATATTAGATGAGGCGACTTCTATGTTAGATCCTGATGCACGTCAAAAT
TTATTGGATTTAGTGAGAAAAGTTAAATCAGAACATAATATTACAATCATTTCTATTACG
CATGATTTATCTGAGGCGATGGAAGCAGATCATGTTATCGTTATGAATAAAGGGACTGTC
TATAAAGAAGGCACAGCGACTGAAATTTTCGACCATGCAGAAGAGTTAACAAGAATAGGT
CTAGATTTGCCATTCCCAATCAAAATAAATCAAATGCTGGGACACCAAACATCATTCTTA
ACTTATGAAGGGCTGGTGGATCAACTATGA60
120
180
240
300
360
420
480
540
600
660
720
780
810
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA2021 [new locus tag: SA_RS11625 ]
- symbol: CbiO
- description: cobalt transporter ATP-binding subunit
- length: 269
- theoretical pI: 5.0317
- theoretical MW: 30046.9
- GRAVY: -0.233457
⊟Function[edit | edit source]
- reaction: EC 3.6.3.-? ExPASy
- TIGRFAM: Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 347.3)and 79 moreTransport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 245.4)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 172.5)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 168.1)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 161.1)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 155)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 155)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 152.5)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 152)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 151.6)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 151.3)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 148.3)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 146.5)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 144.7)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 143.1)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 138.3)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 138.3)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 137.6)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 136.8)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 136.3)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 136.3)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 134.8)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 134.6)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 134.6)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 131.4)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 130.7)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 130.7)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 127.9)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 127.6)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 123)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 122.7)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 119)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 119)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 119)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 118.3)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 117.5)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 115.6)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 115.3)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 115.3)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 113.7)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 113.6)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 111.7)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 110.8)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 107.5)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 104.4)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 104.4)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 98.9)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 96.4)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 95.8)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 95.2)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 93.3)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 92.8)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 92.4)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 82.3)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 82.3)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 81.9)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 81.5)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 80.5)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 80.5)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 76)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 75.2)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 74.3)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 72.4)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 72.4)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 69.5)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 65)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 64.8)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 52.4)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 43.6)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 43.2)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 42.6)Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 25.5)DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 25.5)rad50 (TIGR00606; HMM-score: 15.3)DNA metabolism DNA replication, recombination, and repair DNA replication and repair protein RecF (TIGR00611; HMM-score: 15.2)type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 14.5)KaiC domain protein, PAE1156 family (TIGR03881; HMM-score: 13.7)Cellular processes Cell division chromosome segregation protein SMC (TIGR02169; HMM-score: 13.3)DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02169; HMM-score: 13.3)DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 9.2)
- TheSEED :
- ECF transporter, ATPase component of energizing module
Cofactors, Vitamins, Prosthetic Groups, Pigments Folate and pterines Folate Biosynthesis ATPase component of general energizing module of ECF transportersand 1 more - PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 122.7)and 23 moreSMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 59)AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 30.3)AAA_15; AAA ATPase domain (PF13175; HMM-score: 21.5)AAA_22; AAA domain (PF13401; HMM-score: 20.3)AAA_23; AAA domain (PF13476; HMM-score: 20)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 19.6)SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 19.3)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 18.6)AAA_33; AAA domain (PF13671; HMM-score: 17.1)DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 16.6)TniB; Bacterial TniB protein (PF05621; HMM-score: 16.4)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 15.5)AAA_25; AAA domain (PF13481; HMM-score: 15.4)KdpD; Osmosensitive K+ channel His kinase sensor domain (PF02702; HMM-score: 14.7)RecA; recA bacterial DNA recombination protein (PF00154; HMM-score: 13.9)ATPase; KaiC (PF06745; HMM-score: 13.7)ABC_ATPase; P-loop domain (PF09818; HMM-score: 13.5)AAA_14; AAA domain (PF13173; HMM-score: 12.9)AAA_13; AAA domain (PF13166; HMM-score: 12.5)AAA_17; AAA domain (PF13207; HMM-score: 12.5)TIM_barrel (CL0036) Spherulin4; Spherulation-specific family 4 (PF12138; HMM-score: 12.3)no clan defined NPHP3; Nephrocystin-3 domain (PF25022; HMM-score: 12.1)P-loop_NTPase (CL0023) AAA_18; AAA domain (PF13238; HMM-score: 11.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 1.05
- Cytoplasmic Membrane Score: 8.78
- Cellwall Score: 0.08
- Extracellular Score: 0.09
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.08
- Cytoplasmic Membrane Score: 0.9134
- Cell wall & surface Score: 0.0004
- Extracellular Score: 0.0062
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.00978
- TAT(Tat/SPI): 0.000356
- LIPO(Sec/SPII): 0.002372
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MEDKNSVIVFKNVSFQYQSDASFTLKDVSFNIPKGQWTSIVGHNGSGKSTIAKLMIGIEKVKSGEIFYNNQAITDDNFEKLRKDIGIVFQNPDNQFVGSIVKYDVAFGLENHAVPHDEMHRRVSEALKQVDMLERADYEPNALSGGQKQRVAIASVLALNPSVIILDEATSMLDPDARQNLLDLVRKVKSEHNITIISITHDLSEAMEADHVIVMNKGTVYKEGTATEIFDHAEELTRIGLDLPFPIKINQMLGHQTSFLTYEGLVDQL
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SA1984 (asp23) alkaline shock protein 23 [1] (data from MRSA252) SA1517 (citC) isocitrate dehydrogenase [1] (data from MRSA252) SA0943-1 (pdhA) pyruvate dehydrogenase E1 component subunit alpha [1] (data from MRSA252) SA0497 (rplJ) 50S ribosomal protein L10 [1] (data from MRSA252) SA0498 (rplL) 50S ribosomal protein L7/L12 [1] (data from MRSA252) SA1084 (rplS) 50S ribosomal protein L19 [1] (data from MRSA252) SA2016 (rpsI) 30S ribosomal protein S9 [1] (data from MRSA252) SA0506 (tuf) elongation factor Tu [1] (data from MRSA252) SA2302 hypothetical protein [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: truA < SA2019 < cbiO < cbiO
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)