Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL2211 [new locus tag: SACOL_RS11640 ]
- pan locus tag?: SAUPAN005672000
- symbol: cbiO
- pan gene symbol?: cbiO1
- synonym: ecfA1
- product: cobalt transporter ATP-binding subunit
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL2211 [new locus tag: SACOL_RS11640 ]
- symbol: cbiO
- product: cobalt transporter ATP-binding subunit
- replicon: chromosome
- strand: -
- coordinates: 2292224..2293033
- length: 810
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3238667 NCBI
- RefSeq: YP_187021 NCBI
- BioCyc: see SACOL_RS11640
- MicrobesOnline: 913696 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781GTGGAGGATAAGAATTCAGTTATTGTATTTAAAAATGTTTCATTTCAATATCAAAGTGAT
GCATCCTTCACATTGAAAGATGTTTCTTTTAATATACCTAAAGGTCAGTGGACATCTATT
GTTGGTCATAACGGTTCTGGAAAATCTACAATTGCCAAGTTAATGATTGGCATAGAGAAA
GTTAAATCTGGAGAAATTTTTTATAATAATCAAGCTATAACTGATGATAATTTTGAAAAG
TTAAGAAAAGACATAGGAATTGTATTTCAGAATCCGGATAATCAATTTGTTGGTTCAATT
GTAAAATACGATGTGGCATTTGGACTCGAAAATCATGCGGTTCCATATGACGAAATGCAT
AGAAGAGTCAGCGAAGCACTTAAACAAGTTGATATGTTAGAACGTGCAGATTATGAACCT
AATGCATTATCGGGGGGACAGAAGCAGCGTGTGGCTATAGCAAGTGTATTAGCACTTAAC
CCCTCTGTCATTATATTAGATGAGGCGACTTCTATGTTAGATCCTGATGCACGTCAAAAT
TTATTGGATTTAGTGAGAAAAGTTAAATCAGAACATAATATTACAATCATTTCTATTACG
CATGATTTATCTGAGGCGATGGAAGCAGATCATGTTATCGTTATGAATAAAGGGACTGTC
TATAAAGAAGGCACAGCGACTGAAATTTTCGACAATGCAGAAGAGTTAACAAGAATAGGT
CTAGATTTGCCATTCCCAATCAAAATAAATCAAATGCTGGGACACCAAACATCATTCTTA
ACTTATGAAGGGCTGGTGGATCAACTATGA60
120
180
240
300
360
420
480
540
600
660
720
780
810
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL2211 [new locus tag: SACOL_RS11640 ]
- symbol: CbiO
- description: cobalt transporter ATP-binding subunit
- length: 269
- theoretical pI: 4.8143
- theoretical MW: 30049.9
- GRAVY: -0.227509
⊟Function[edit | edit source]
- reaction: EC 3.6.3.-? ExPASy
- TIGRFAM: Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 346.4)and 82 moreTransport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 244.1)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 170.7)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 166.6)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 159.8)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 154.5)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 154.5)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 152.8)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 152.4)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 150.3)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 149.9)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 146.5)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 145.7)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 144.4)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 140.4)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 137.3)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 137.3)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 136.7)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 136.5)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 135.6)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 135.6)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 133.8)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 133.1)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 133.1)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 129.9)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 129.8)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 129.8)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 127.5)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 126.8)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 122.6)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 121.9)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 118.4)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 118.3)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 118.3)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 118.3)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 116.2)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 114.8)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 114.3)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 114.3)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 113.4)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 112.9)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 112)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 111)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 106.8)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 104.3)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 104.3)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 98)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 95.8)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 95.4)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 95.2)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 93.9)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 93.4)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 92.3)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 81.5)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 81.5)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 81.3)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 80.3)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 80.3)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 80)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 78.3)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 74.8)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 72.5)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 72.2)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 72.2)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 69.5)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 65.8)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 63.4)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 52.3)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 43.6)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 43)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 42.5)Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 25.5)DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 25.5)rad50 (TIGR00606; HMM-score: 15.4)DNA metabolism DNA replication, recombination, and repair DNA replication and repair protein RecF (TIGR00611; HMM-score: 15.3)type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 14.4)KaiC domain protein, PAE1156 family (TIGR03881; HMM-score: 13.5)Cellular processes Cell division chromosome segregation protein SMC (TIGR02169; HMM-score: 13.3)DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02169; HMM-score: 13.3)DNA repair and recombination protein RadB (TIGR02237; HMM-score: 12)Cellular processes Toxin production and resistance prevent-host-death family protein (TIGR01552; HMM-score: 11.2)Mobile and extrachromosomal element functions Other prevent-host-death family protein (TIGR01552; HMM-score: 11.2)DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 9.2)
- TheSEED :
- ATPase component of general energizing module of ECF transporters
Cofactors, Vitamins, Prosthetic Groups, Pigments Folate and pterines Folate Biosynthesis ATPase component of general energizing module of ECF transportersand 1 more - PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 122.7)and 23 moreSMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 58.8)AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 30.6)AAA_15; AAA ATPase domain (PF13175; HMM-score: 21)AAA_22; AAA domain (PF13401; HMM-score: 20.4)AAA_23; AAA domain (PF13476; HMM-score: 20.2)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 19.5)SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 19.3)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 18.6)AAA_33; AAA domain (PF13671; HMM-score: 16.9)DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 16.6)TniB; Bacterial TniB protein (PF05621; HMM-score: 16.4)KdpD; Osmosensitive K+ channel His kinase sensor domain (PF02702; HMM-score: 15.3)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 15.1)AAA_25; AAA domain (PF13481; HMM-score: 15.1)RecA; recA bacterial DNA recombination protein (PF00154; HMM-score: 13.8)ATPase; KaiC (PF06745; HMM-score: 13.6)ABC_ATPase; P-loop domain (PF09818; HMM-score: 13.5)AAA_14; AAA domain (PF13173; HMM-score: 13.2)AAA_13; AAA domain (PF13166; HMM-score: 12.5)AAA_17; AAA domain (PF13207; HMM-score: 12.5)RNA_helicase; RNA helicase (PF00910; HMM-score: 12.2)TIM_barrel (CL0036) Spherulin4; Spherulation-specific family 4 (PF12138; HMM-score: 12.1)P-loop_NTPase (CL0023) AAA_18; AAA domain (PF13238; HMM-score: 11.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 1.05
- Cytoplasmic Membrane Score: 8.78
- Cellwall Score: 0.08
- Extracellular Score: 0.09
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.0707
- Cytoplasmic Membrane Score: 0.9216
- Cell wall & surface Score: 0.0004
- Extracellular Score: 0.0073
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.00978
- TAT(Tat/SPI): 0.000356
- LIPO(Sec/SPII): 0.002372
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MEDKNSVIVFKNVSFQYQSDASFTLKDVSFNIPKGQWTSIVGHNGSGKSTIAKLMIGIEKVKSGEIFYNNQAITDDNFEKLRKDIGIVFQNPDNQFVGSIVKYDVAFGLENHAVPYDEMHRRVSEALKQVDMLERADYEPNALSGGQKQRVAIASVLALNPSVIILDEATSMLDPDARQNLLDLVRKVKSEHNITIISITHDLSEAMEADHVIVMNKGTVYKEGTATEIFDNAEELTRIGLDLPFPIKINQMLGHQTSFLTYEGLVDQL
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2]
- quantitative data / protein copy number per cell: 27 [3]
- interaction partners:
SACOL1741 (icd) isocitrate dehydrogenase [4] (data from MRSA252) SACOL1102 (pdhA) pyruvate dehydrogenase complex E1 component subunit alpha [4] (data from MRSA252) SACOL0585 (rplJ) 50S ribosomal protein L10 [4] (data from MRSA252) SACOL0586 (rplL) 50S ribosomal protein L7/L12 [4] (data from MRSA252) SACOL1257 (rplS) 50S ribosomal protein L19 [4] (data from MRSA252) SACOL2206 (rpsI) 30S ribosomal protein S9 [4] (data from MRSA252) SACOL0594 (tuf) elongation factor Tu [4] (data from MRSA252) SACOL2173 alkaline shock protein 23 [4] (data from MRSA252) SACOL2525 ABC transporter ATP-binding protein [4] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: truA < SACOL2209 < cbiO < cbiO
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e) - ↑ 4.0 4.1 4.2 4.3 4.4 4.5 4.6 4.7 4.8 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)