Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL0136 [new locus tag: SACOL_RS00690 ]
- pan locus tag?: SAUPAN000974000
- symbol: cap5A
- pan gene symbol?: capA
- synonym:
- product: capsular polysaccharide biosynthesis protein Cap5A
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL0136 [new locus tag: SACOL_RS00690 ]
- symbol: cap5A
- product: capsular polysaccharide biosynthesis protein Cap5A
- replicon: chromosome
- strand: +
- coordinates: 153405..154073
- length: 669
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3236369 NCBI
- RefSeq: YP_185036 NCBI
- BioCyc:
- MicrobesOnline: 911613 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661ATGGAAAGTACATTAGAATTAACAAAAATTAAAGAAGTATTACAAAAAAACTTGAAGATT
TTAATTATTTTACCGCTATTATTTTTAATTATTAGCGCTATTGTTACATTTTTCGTCTTA
TCACCTAAATATCAAGCTAATACTCAAATTTTAGTGAATCAAACTAAGGGTGACAATCCT
CAGTTTATGGCGCAAGAGGTTCAAAGTAATATTCAACTTGTAAATACGTATAAAGAAATT
GTTAAAAGTCCTAGAATTTTAGATGAGGTGTCAAAGGACTTAAATGATAAGTATTCACCA
TCTAAATTGTCGAGTATGTTGACAATTACAAACCAAGAAAATACGCAACTTATCAACATC
CAAGTTAAAAGTGGTCATAAACAAGATTCGGAAAAAATTGCGAATAGCTTCGCTAAAGTT
ACAAGTAAACAAATTCCGAAGATTATGAGTGTGGATAACGTATCAATTTTATCTAAAGCA
GACGGTACAGCAGTTAAAGTCGCACCAAAAACTGTAGTGAATCTAATCGGTGCATTCTTT
TTAGGATTAGTTGTCGCGCTTATATATATCTTCTTCAAAGTAATTTTCGATAAGCGAATT
AAAGATGAAGAAGATGTAGAGAAAGAATTAGGATTGCCTGTATTGGGTTCAATTCAAAAA
TTTAATTAA60
120
180
240
300
360
420
480
540
600
660
669
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL0136 [new locus tag: SACOL_RS00690 ]
- symbol: Cap5A
- description: capsular polysaccharide biosynthesis protein Cap5A
- length: 222
- theoretical pI: 9.86158
- theoretical MW: 24854
- GRAVY: 0.0869369
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Carbohydrates, organic alcohols, and acids polysaccharide export protein, MPA1 family (TIGR01006; HMM-score: 322.3)and 4 morechain length determinant protein EpsF (TIGR03017; HMM-score: 42)Transport and binding proteins Carbohydrates, organic alcohols, and acids exopolysaccharide transport protein family (TIGR01005; HMM-score: 30.8)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides polysaccharide chain length determinant protein, PEP-CTERM locus subfamily (TIGR03007; HMM-score: 16.2)HAD hydrolase, TIGR01459 family (TIGR01459; HMM-score: 12.9)
- TheSEED:
- PFAM: no clan defined Wzz; Chain length determinant protein (PF02706; HMM-score: 82.7)and 7 moreGNVR; G-rich domain on putative tyrosine kinase (PF13807; HMM-score: 24.4)LapA_dom; Lipopolysaccharide assembly protein A domain (PF06305; HMM-score: 13.3)DUF1189; Protein of unknown function (DUF1189) (PF06691; HMM-score: 12.5)DUF2663; Protein of unknown function (DUF2663) (PF10864; HMM-score: 11.9)DUF5469; Family of unknown function (DUF5469) (PF17561; HMM-score: 10.4)DUF3671; Protein of unknown function (PF12420; HMM-score: 6.8)DUF3985; Protein of unknown function (DUF3985) (PF13153; HMM-score: 6.5)
⊟Structure, modifications & interactions[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
- protein partners:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.32
- Cytoplasmic Membrane Score: 9.55
- Cellwall Score: 0.12
- Extracellular Score: 0.01
- Internal Helices: 2
- LocateP: Multi-transmembrane
- Prediction by SwissProt Classification: Membrane
- Pathway Prediction: Sec-(SPI)
- Intracellular possibility: 0.17
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.054736
- TAT(Tat/SPI): 0.000669
- LIPO(Sec/SPII): 0.003427
- predicted transmembrane helices (TMHMM): 2
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MESTLELTKIKEVLQKNLKILIILPLLFLIISAIVTFFVLSPKYQANTQILVNQTKGDNPQFMAQEVQSNIQLVNTYKEIVKSPRILDEVSKDLNDKYSPSKLSSMLTITNQENTQLINIQVKSGHKQDSEKIANSFAKVTSKQIPKIMSVDNVSILSKADGTAVKVAPKTVVNLIGAFFLGLVVALIYIFFKVIFDKRIKDEEDVEKELGLPVLGSIQKFN
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: cap5A > cap5B > cap5C > cap5D > cap5E > cap5F > cap5G > cap5H > cap5I > cap5J > cap5K > cap5L > cap5M > cap5N > cap5O > cap5P
⊟Regulation[edit | edit source]
- regulators: CodY (repression) regulon, SigB* (activation) regulon
CodY (TF) important in Amino acid metabolism; RegPrecise SigB (sigma factor) controlling a large regulon involved in stress/starvation response and adaptation [5] [6] other strains
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
J Proteome Res: 2010, 9(3);1579-90
[PubMed:20108986] [WorldCat.org] [DOI] (I p) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
J Bacteriol: 2004, 186(13);4085-99
[PubMed:15205410] [WorldCat.org] [DOI] (P p) - ↑ Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
The sigmaB regulon in Staphylococcus aureus and its regulation.
Int J Med Microbiol: 2006, 296(4-5);237-58
[PubMed:16644280] [WorldCat.org] [DOI] (P p)
⊟Relevant publications[edit | edit source]