From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0136 [new locus tag: SACOL_RS00690 ]
  • pan locus tag?: SAUPAN000974000
  • symbol: cap5A
  • pan gene symbol?: capA
  • synonym:
  • product: capsular polysaccharide biosynthesis protein Cap5A

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL0136 [new locus tag: SACOL_RS00690 ]
  • symbol: cap5A
  • product: capsular polysaccharide biosynthesis protein Cap5A
  • replicon: chromosome
  • strand: +
  • coordinates: 153405..154073
  • length: 669
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGGAAAGTACATTAGAATTAACAAAAATTAAAGAAGTATTACAAAAAAACTTGAAGATT
    TTAATTATTTTACCGCTATTATTTTTAATTATTAGCGCTATTGTTACATTTTTCGTCTTA
    TCACCTAAATATCAAGCTAATACTCAAATTTTAGTGAATCAAACTAAGGGTGACAATCCT
    CAGTTTATGGCGCAAGAGGTTCAAAGTAATATTCAACTTGTAAATACGTATAAAGAAATT
    GTTAAAAGTCCTAGAATTTTAGATGAGGTGTCAAAGGACTTAAATGATAAGTATTCACCA
    TCTAAATTGTCGAGTATGTTGACAATTACAAACCAAGAAAATACGCAACTTATCAACATC
    CAAGTTAAAAGTGGTCATAAACAAGATTCGGAAAAAATTGCGAATAGCTTCGCTAAAGTT
    ACAAGTAAACAAATTCCGAAGATTATGAGTGTGGATAACGTATCAATTTTATCTAAAGCA
    GACGGTACAGCAGTTAAAGTCGCACCAAAAACTGTAGTGAATCTAATCGGTGCATTCTTT
    TTAGGATTAGTTGTCGCGCTTATATATATCTTCTTCAAAGTAATTTTCGATAAGCGAATT
    AAAGATGAAGAAGATGTAGAGAAAGAATTAGGATTGCCTGTATTGGGTTCAATTCAAAAA
    TTTAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    669

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL0136 [new locus tag: SACOL_RS00690 ]
  • symbol: Cap5A
  • description: capsular polysaccharide biosynthesis protein Cap5A
  • length: 222
  • theoretical pI: 9.86158
  • theoretical MW: 24854
  • GRAVY: 0.0869369

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids polysaccharide export protein, MPA1 family (TIGR01006; HMM-score: 322.3)
    and 4 more
    chain length determinant protein EpsF (TIGR03017; HMM-score: 42)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids exopolysaccharide transport protein family (TIGR01005; HMM-score: 30.8)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides polysaccharide chain length determinant protein, PEP-CTERM locus subfamily (TIGR03007; HMM-score: 16.2)
    HAD hydrolase, TIGR01459 family (TIGR01459; HMM-score: 12.9)
  • TheSEED  :
    • Capsular polysaccharide synthesis enzyme CapA
    • Tyrosine-protein kinase transmembrane modulator EpsC
    Cell Wall and Capsule Capsular and extracellular polysacchrides Exopolysaccharide Biosynthesis  Tyrosine-protein kinase transmembrane modulator EpsC
  • PFAM:
    no clan defined Wzz; Chain length determinant protein (PF02706; HMM-score: 82.7)
    and 7 more
    GNVR; G-rich domain on putative tyrosine kinase (PF13807; HMM-score: 24.4)
    LapA_dom; Lipopolysaccharide assembly protein A domain (PF06305; HMM-score: 13.3)
    DUF1189; Protein of unknown function (DUF1189) (PF06691; HMM-score: 12.5)
    DUF2663; Protein of unknown function (DUF2663) (PF10864; HMM-score: 11.9)
    DUF5469; Family of unknown function (DUF5469) (PF17561; HMM-score: 10.4)
    DUF3671; Protein of unknown function (PF12420; HMM-score: 6.8)
    DUF3985; Protein of unknown function (DUF3985) (PF13153; HMM-score: 6.5)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.32
    • Cytoplasmic Membrane Score: 9.55
    • Cellwall Score: 0.12
    • Extracellular Score: 0.01
    • Internal Helices: 2
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.054736
    • TAT(Tat/SPI): 0.000669
    • LIPO(Sec/SPII): 0.003427
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MESTLELTKIKEVLQKNLKILIILPLLFLIISAIVTFFVLSPKYQANTQILVNQTKGDNPQFMAQEVQSNIQLVNTYKEIVKSPRILDEVSKDLNDKYSPSKLSSMLTITNQENTQLINIQVKSGHKQDSEKIANSFAKVTSKQIPKIMSVDNVSILSKADGTAVKVAPKTVVNLIGAFFLGLVVALIYIFFKVIFDKRIKDEEDVEKELGLPVLGSIQKFN

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Integral membrane [1] [2] [3] [4]
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulators: CodY (repression) regulon, SigB* (activation) regulon
    CodY(TF)important in Amino acid metabolism; RegPrecise 
    SigB*(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation;  [7] [8]   other strains

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J Proteome Res: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. Daniela Keinhörster, Shilpa Elizabeth George, Christopher Weidenmaier, Christiane Wolz
    Function and regulation of Staphylococcus aureus wall teichoic acids and capsular polysaccharides.
    Int J Med Microbiol: 2019, 309(6);151333
    [PubMed:31362856] [WorldCat.org] [DOI] (I p)
  6. S Sau, J Sun, C Y Lee
    Molecular characterization and transcriptional analysis of type 8 capsule genes in Staphylococcus aureus.
    J Bacteriol: 1997, 179(5);1614-21
    [PubMed:9045821] [WorldCat.org] [DOI] (P p)
  7. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J Bacteriol: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)
  8. Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
    The sigmaB regulon in Staphylococcus aureus and its regulation.
    Int J Med Microbiol: 2006, 296(4-5);237-58
    [PubMed:16644280] [WorldCat.org] [DOI] (P p)

Relevant publications[edit | edit source]