From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00114
  • pan locus tag?: SAUPAN000974000
  • symbol: SAOUHSC_00114
  • pan gene symbol?: capA
  • synonym:
  • product: capsular polysaccharide biosynthesis protein

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_00114
  • symbol: SAOUHSC_00114
  • product: capsular polysaccharide biosynthesis protein
  • replicon: chromosome
  • strand: +
  • coordinates: 119492..120160
  • length: 669
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGGAAAGTACATTAGAATTAACAAAAATTAAAGAAGTATTACAAAAAAACTTGAAGATT
    TTAATTATTTTACCGCTATTATTTTTAATTATTAGCGCTATTGTTACATTTTTCGTCTTA
    TCACCTAAATATCAAGCTAATACTCAAATTTTAGTGAATCAAACTAAGGGTGACAATCCT
    CAGTTTATGGCGCAAGAGGTTCAAAGTAATATTCAACTTGTAAATACGTATAAAGAAATT
    GTTAAAAGTCCTAGAATTTTAGATGAGGTGTCAAAGGACTTAAATGATAAGTATTCACCA
    TCTAAATTGTCGAGTATGTTGACAATTACAAACCAAGAAAATACGCAACTTATCAACATC
    CAAGTTAAAAGTGGTCATAAACAAGATTCGGAAAAAATTGCGAATAGCTTCGCTAAAGTT
    ACAAGTAAACAAATTCCGAAGATTATGAGTGTGGATAACGTATCAATTTTATCTAAAGCA
    GACGGTACAGCAGTTAAAGTCGCACCAAAAACTGTAGTGAATCTAATCGGTGCATTCTTT
    TTAGGATTAGTTGTCGCGCTTATATATATCTTCTTCAAAGTAATTTTCGATAAGCGAATT
    AAAGATGAAGAAGATGTAGAGAAAGAATTAGGATTGCCTGTATTGGGTTCAATTCAAAAA
    TTTAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    669

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAOUHSC_00114
  • symbol: SAOUHSC_00114
  • description: capsular polysaccharide biosynthesis protein
  • length: 222
  • theoretical pI: 9.86158
  • theoretical MW: 24854
  • GRAVY: 0.0869369

⊟Function[edit | edit source]

  • TIGRFAM:
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids polysaccharide export protein, MPA1 family (TIGR01006; HMM-score: 322.3)
    and 4 more
    chain length determinant protein EpsF (TIGR03017; HMM-score: 42)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids exopolysaccharide transport protein family (TIGR01005; HMM-score: 30.8)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides polysaccharide chain length determinant protein, PEP-CTERM locus subfamily (TIGR03007; HMM-score: 16.2)
    HAD hydrolase, TIGR01459 family (TIGR01459; HMM-score: 12.9)
  • TheSEED  :
    • Capsular polysaccharide synthesis enzyme CapA
    • Tyrosine-protein kinase transmembrane modulator EpsC
    Cell Wall and Capsule Capsular and extracellular polysacchrides Exopolysaccharide Biosynthesis  Tyrosine-protein kinase transmembrane modulator EpsC
  • PFAM:
    no clan defined Wzz; Chain length determinant protein (PF02706; HMM-score: 82.7)
    and 7 more
    GNVR; G-rich domain on putative tyrosine kinase (PF13807; HMM-score: 24.4)
    LapA_dom; Lipopolysaccharide assembly protein A domain (PF06305; HMM-score: 13.3)
    DUF1189; Protein of unknown function (DUF1189) (PF06691; HMM-score: 12.5)
    DUF2663; Protein of unknown function (DUF2663) (PF10864; HMM-score: 11.9)
    DUF5469; Family of unknown function (DUF5469) (PF17561; HMM-score: 10.4)
    DUF3671; Protein of unknown function (PF12420; HMM-score: 6.8)
    DUF3985; Protein of unknown function (DUF3985) (PF13153; HMM-score: 6.5)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.32
    • Cytoplasmic Membrane Score: 9.55
    • Cellwall Score: 0.12
    • Extracellular Score: 0.01
    • Internal Helices: 2
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.054736
    • TAT(Tat/SPI): 0.000669
    • LIPO(Sec/SPII): 0.003427
  • predicted transmembrane helices (TMHMM): 2

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MESTLELTKIKEVLQKNLKILIILPLLFLIISAIVTFFVLSPKYQANTQILVNQTKGDNPQFMAQEVQSNIQLVNTYKEIVKSPRILDEVSKDLNDKYSPSKLSSMLTITNQENTQLINIQVKSGHKQDSEKIANSFAKVTSKQIPKIMSVDNVSILSKADGTAVKVAPKTVVNLIGAFFLGLVVALIYIFFKVIFDKRIKDEEDVEKELGLPVLGSIQKFN

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas [1] [2]
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulators: CodY* (repression) regulon, SigB* (activation) regulon
    CodY*(TF)important in Amino acid metabolism; RegPrecise 
    SigB*(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation;  [6] [3]   other strains

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. ↑ 3.0 3.1 3.2 3.3 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)
  4. ↑ Daniela Keinhörster, Shilpa Elizabeth George, Christopher Weidenmaier, Christiane Wolz
    Function and regulation of Staphylococcus aureus wall teichoic acids and capsular polysaccharides.
    Int J Med Microbiol: 2019, 309(6);151333
    [PubMed:31362856] [WorldCat.org] [DOI] (I p)
  5. ↑ S Sau, J Sun, C Y Lee
    Molecular characterization and transcriptional analysis of type 8 capsule genes in Staphylococcus aureus.
    J Bacteriol: 1997, 179(5);1614-21
    [PubMed:9045821] [WorldCat.org] [DOI] (P p)
  6. ↑ Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J Bacteriol: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)

⊟Relevant publications[edit | edit source]

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=SAOUHSC_00114&oldid=93010"