From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02298
  • pan locus tag?: SAUPAN005333000
  • symbol: SAOUHSC_02298
  • pan gene symbol?: sigB
  • synonym:
  • product: RNA polymerase sigma factor SigB

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_02298
  • symbol: SAOUHSC_02298
  • product: RNA polymerase sigma factor SigB
  • replicon: chromosome
  • strand: -
  • coordinates: 2131929..2132699
  • length: 771
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGGCGAAAGAGTCGAAATCAGCTAATGAAATTTCACCTGAGCAAATTAACCAATGGATT
    AAAGAACACCAAGAAAATAAGAATACAGATGCACAGGATAAGTTAGTTAAACATTACCAA
    AAACTAATTGAGTCATTGGCATATAAATATTCTAAAGGACAATCACATCACGAAGATTTA
    GTTCAAGTTGGTATGGTTGGTTTAATAGGTGCCATAAATAGATTCGATATGTCCTTTGAA
    CGGAAGTTTGAAGCCTTTTTAGTACCTACTGTAATCGGTGAAATCAAAAGATATCTACGA
    GATAAAACTTGGAGTGTACATGTTCCGAGACGTATTAAAGAAATTGGGCCAAGAATCAAA
    AAAGTGAGCGATGAACTAACCGCTGAATTAGAGCGTTCACCTTCTATCAGTGAAATAGCT
    GATCGATTAGAAGTCTCAGAAGAAGAAGTGTTAGAAGCAATGGAAATGGGACAAAGTTAT
    AATGCGTTAAGTGTTGATCATTCCATTGAAGCTGATAAAGATGGTTCAACTGTTACGCTA
    TTAGATATTATGGGGCAACAAGATGACCATTATGACTTAACTGAAAAACGTATGATTTTA
    GAAAAAATATTACCTATATTATCTGATCGCGAACGAGAAATCATACAATGTACGTTTATT
    GAAGGATTGAGTCAAAAAGAGACAGGTGAGCGTATCGGTTTAAGTCAAATGCATGTATCA
    CGACTTCAGAGAACGGCAATTAAGAAATTACAAGAAGCAGCACATCAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    771

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAOUHSC_02298
  • symbol: SAOUHSC_02298
  • description: RNA polymerase sigma factor SigB
  • length: 256
  • theoretical pI: 5.645
  • theoretical MW: 29443.3
  • GRAVY: -0.616016

⊟Function[edit | edit source]

  • TIGRFAM:
    RNA polymerase sigma-B factor (TIGR02941; HMM-score: 485.3)
    and 30 more
    RNA polymerase sigma-70 factor, sigma-B/F/G subfamily (TIGR02980; HMM-score: 303.8)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-F factor (TIGR02885; HMM-score: 179.8)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-F factor (TIGR02885; HMM-score: 179.8)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-G factor (TIGR02850; HMM-score: 145.1)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-G factor (TIGR02850; HMM-score: 145.1)
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 138.1)
    RNA polymerase sigma factor, FliA/WhiG family (TIGR02479; HMM-score: 119.6)
    RNA polymerase sigma factor, cyanobacterial RpoD-like family (TIGR02997; HMM-score: 92.6)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma factor RpoD (TIGR02393; HMM-score: 81.4)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-K factor (TIGR02846; HMM-score: 69.9)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-K factor (TIGR02846; HMM-score: 69.9)
    Cellular processes Cellular processes Adaptations to atypical conditions alternative sigma factor RpoH (TIGR02392; HMM-score: 67.8)
    Genetic information processing Transcription Transcription factors alternative sigma factor RpoH (TIGR02392; HMM-score: 67.8)
    Cellular processes Cellular processes Adaptations to atypical conditions RNA polymerase sigma factor RpoS (TIGR02394; HMM-score: 65.4)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma factor RpoS (TIGR02394; HMM-score: 65.4)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-E factor (TIGR02835; HMM-score: 63)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-E factor (TIGR02835; HMM-score: 63)
    RNA polymerase sigma-70 factor, Bacteroides expansion family 1 (TIGR02985; HMM-score: 47)
    RNA polymerase sigma-70 factor, Planctomycetaceae-specific subfamily 1 (TIGR02984; HMM-score: 35.8)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-H factor (TIGR02859; HMM-score: 35.1)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-H factor (TIGR02859; HMM-score: 35.1)
    RNA polymerase sigma-70 factor, TIGR02952 family (TIGR02952; HMM-score: 34)
    RNA polymerase sigma factor, SigZ family (TIGR02959; HMM-score: 26.3)
    RNA polymerase sigma-70 factor, sigma-E family (TIGR02983; HMM-score: 23.3)
    RNA polymerase sigma factor, TIGR02999 family (TIGR02999; HMM-score: 21.2)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-I factor (TIGR02895; HMM-score: 19.7)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-I factor (TIGR02895; HMM-score: 19.7)
    RNA polymerase sigma-70 factor, Rhodopirellula/Verrucomicrobium family (TIGR02989; HMM-score: 18.8)
    RNA polymerase sigma-70 factor, Myxococcales family 1 (TIGR03001; HMM-score: 16.2)
    RNA polymerase sigma factor RpoE (TIGR02939; HMM-score: 13.7)
  • TheSEED  :
    • RNA polymerase sigma factor SigB
    Regulation and Cell signaling Quorum sensing and biofilm formation Biofilm formation in Staphylococcus  RNA polymerase sigma factor SigB
    and 2 more
    RNA Metabolism Transcription Transcription initiation, bacterial sigma factors  RNA polymerase sigma factor SigB
    Stress Response Stress Response - no subcategory SigmaB stress responce regulation  RNA polymerase sigma factor SigB
  • PFAM:
    HTH (CL0123) Sigma70_r3; Sigma-70 region 3 (PF04539; HMM-score: 64.1)
    Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 62.8)
    Sigma70_r2; Sigma-70 region 2 (PF04542; HMM-score: 61.7)
    and 16 more
    Sigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 26.5)
    Sigma70_ECF; ECF sigma factor (PF07638; HMM-score: 23)
    GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 21.9)
    HTH_16; Helix-turn-helix domain (PF12645; HMM-score: 21.6)
    HTH_23; Homeodomain-like domain (PF13384; HMM-score: 19.8)
    HTH_3; Helix-turn-helix (PF01381; HMM-score: 16.8)
    IF2_N; Translation initiation factor IF-2, N-terminal region (PF04760; HMM-score: 16.7)
    HTH_Tnp_1; Transposase (PF01527; HMM-score: 16.6)
    HTH_38; Helix-turn-helix domain (PF13936; HMM-score: 16.3)
    KORA; TrfB plasmid transcriptional repressor (PF16509; HMM-score: 16.1)
    HTH_37; Helix-turn-helix domain (PF13744; HMM-score: 15)
    HTH_AsnC-type; AsnC-type helix-turn-helix domain (PF13404; HMM-score: 14.8)
    HTH_31; Helix-turn-helix domain (PF13560; HMM-score: 14.8)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 13.6)
    HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 13)
    HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 12.3)

⊟Structure, modifications & cofactors[edit | edit source]

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007397
    • TAT(Tat/SPI): 0.000536
    • LIPO(Sec/SPII): 0.000631
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MAKESKSANEISPEQINQWIKEHQENKNTDAQDKLVKHYQKLIESLAYKYSKGQSHHEDLVQVGMVGLIGAINRFDMSFERKFEAFLVPTVIGEIKRYLRDKTWSVHVPRRIKEIGPRIKKVSDELTAELERSPSISEIADRLEVSEEEVLEAMEMGQSYNALSVDHSIEADKDGSTVTLLDIMGQQDDHYDLTEKRMILEKILPILSDREREIIQCTFIEGLSQKETGERIGLSQMHVSRLQRTAIKKLQEAAHQ

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas [3] [4]
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SAOUHSC_00519(rplA)50S ribosomal protein L1  [5] (data from MRSA252)
    SAOUHSC_01211(rplS)50S ribosomal protein L19  [5] (data from MRSA252)
    SAOUHSC_01757(rplU)50S ribosomal protein L21  [5] (data from MRSA252)
    SAOUHSC_00524(rpoB)DNA-directed RNA polymerase subunit beta  [5] (data from MRSA252)
    SAOUHSC_00315hypothetical protein  [5] (data from MRSA252)
    SAOUHSC_00525DNA-directed RNA polymerase subunit beta'  [5] (data from MRSA252)
    SAOUHSC_01036hypothetical protein  [5] (data from MRSA252)
    SAOUHSC_01040pyruvate dehydrogenase complex, E1 component subunit alpha  [5] (data from MRSA252)
    SAOUHSC_01041pyruvate dehydrogenase complex, E1 component subunit beta  [5] (data from MRSA252)
    SAOUHSC_01042branched-chain alpha-keto acid dehydrogenase subunit E2  [5] (data from MRSA252)
    SAOUHSC_01043dihydrolipoamide dehydrogenase  [5] (data from MRSA252)
    SAOUHSC_01490DNA-binding protein HU  [5] (data from MRSA252)
    SAOUHSC_02299serine-protein kinase RsbW  [5] (data from MRSA252)
    SAOUHSC_02369DNA-directed RNA polymerase subunit delta  [5] (data from MRSA252)
    SAOUHSC_02485DNA-directed RNA polymerase subunit alpha  [5] (data from MRSA252)

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator: SigB* (activation) regulon
    SigB*(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation;  [1]   other strains

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ 1.0 1.1 Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J Bacteriol: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)
  2. ↑ 2.0 2.1 2.2 2.3 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)
  3. ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  4. ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  5. ↑ 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Niles P Donegan, Ambrose L Cheung
Regulation of the mazEF toxin-antitoxin module in Staphylococcus aureus and its impact on sigB expression.
J Bacteriol: 2009, 191(8);2795-805
[PubMed:19181798] [WorldCat.org] [DOI] (I p)

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=SAOUHSC_02298&oldid=95483"