Jump to navigation
Jump to search
NCBI: 03-AUG-2016
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: SAOUHSC_02298
- pan locus tag?: SAUPAN005333000
- symbol: SAOUHSC_02298
- pan gene symbol?: sigB
- synonym:
- product: RNA polymerase sigma factor SigB
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAOUHSC_02298
- symbol: SAOUHSC_02298
- product: RNA polymerase sigma factor SigB
- replicon: chromosome
- strand: -
- coordinates: 2131929..2132699
- length: 771
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3919169 NCBI
- RefSeq: YP_500776 NCBI
- BioCyc: G1I0R-2170 BioCyc
- MicrobesOnline: 1290737 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721ATGGCGAAAGAGTCGAAATCAGCTAATGAAATTTCACCTGAGCAAATTAACCAATGGATT
AAAGAACACCAAGAAAATAAGAATACAGATGCACAGGATAAGTTAGTTAAACATTACCAA
AAACTAATTGAGTCATTGGCATATAAATATTCTAAAGGACAATCACATCACGAAGATTTA
GTTCAAGTTGGTATGGTTGGTTTAATAGGTGCCATAAATAGATTCGATATGTCCTTTGAA
CGGAAGTTTGAAGCCTTTTTAGTACCTACTGTAATCGGTGAAATCAAAAGATATCTACGA
GATAAAACTTGGAGTGTACATGTTCCGAGACGTATTAAAGAAATTGGGCCAAGAATCAAA
AAAGTGAGCGATGAACTAACCGCTGAATTAGAGCGTTCACCTTCTATCAGTGAAATAGCT
GATCGATTAGAAGTCTCAGAAGAAGAAGTGTTAGAAGCAATGGAAATGGGACAAAGTTAT
AATGCGTTAAGTGTTGATCATTCCATTGAAGCTGATAAAGATGGTTCAACTGTTACGCTA
TTAGATATTATGGGGCAACAAGATGACCATTATGACTTAACTGAAAAACGTATGATTTTA
GAAAAAATATTACCTATATTATCTGATCGCGAACGAGAAATCATACAATGTACGTTTATT
GAAGGATTGAGTCAAAAAGAGACAGGTGAGCGTATCGGTTTAAGTCAAATGCATGTATCA
CGACTTCAGAGAACGGCAATTAAGAAATTACAAGAAGCAGCACATCAATAG60
120
180
240
300
360
420
480
540
600
660
720
771
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAOUHSC_02298
- symbol: SAOUHSC_02298
- description: RNA polymerase sigma factor SigB
- length: 256
- theoretical pI: 5.645
- theoretical MW: 29443.3
- GRAVY: -0.616016
⊟Function[edit | edit source]
- TIGRFAM: RNA polymerase sigma-B factor (TIGR02941; HMM-score: 485.3)and 30 moreRNA polymerase sigma-70 factor, sigma-B/F/G subfamily (TIGR02980; HMM-score: 303.8)Cellular processes Sporulation and germination RNA polymerase sigma-F factor (TIGR02885; HMM-score: 179.8)Transcription Transcription factors RNA polymerase sigma-F factor (TIGR02885; HMM-score: 179.8)Cellular processes Sporulation and germination RNA polymerase sigma-G factor (TIGR02850; HMM-score: 145.1)Transcription Transcription factors RNA polymerase sigma-G factor (TIGR02850; HMM-score: 145.1)RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 138.1)RNA polymerase sigma factor, FliA/WhiG family (TIGR02479; HMM-score: 119.6)RNA polymerase sigma factor, cyanobacterial RpoD-like family (TIGR02997; HMM-score: 92.6)Transcription Transcription factors RNA polymerase sigma factor RpoD (TIGR02393; HMM-score: 81.4)Cellular processes Sporulation and germination RNA polymerase sigma-K factor (TIGR02846; HMM-score: 69.9)Transcription Transcription factors RNA polymerase sigma-K factor (TIGR02846; HMM-score: 69.9)Cellular processes Adaptations to atypical conditions alternative sigma factor RpoH (TIGR02392; HMM-score: 67.8)Transcription Transcription factors alternative sigma factor RpoH (TIGR02392; HMM-score: 67.8)Cellular processes Adaptations to atypical conditions RNA polymerase sigma factor RpoS (TIGR02394; HMM-score: 65.4)Transcription Transcription factors RNA polymerase sigma factor RpoS (TIGR02394; HMM-score: 65.4)Cellular processes Sporulation and germination RNA polymerase sigma-E factor (TIGR02835; HMM-score: 63)Transcription Transcription factors RNA polymerase sigma-E factor (TIGR02835; HMM-score: 63)RNA polymerase sigma-70 factor, Bacteroides expansion family 1 (TIGR02985; HMM-score: 47)RNA polymerase sigma-70 factor, Planctomycetaceae-specific subfamily 1 (TIGR02984; HMM-score: 35.8)Cellular processes Sporulation and germination RNA polymerase sigma-H factor (TIGR02859; HMM-score: 35.1)Transcription Transcription factors RNA polymerase sigma-H factor (TIGR02859; HMM-score: 35.1)RNA polymerase sigma-70 factor, TIGR02952 family (TIGR02952; HMM-score: 34)RNA polymerase sigma factor, SigZ family (TIGR02959; HMM-score: 26.3)RNA polymerase sigma-70 factor, sigma-E family (TIGR02983; HMM-score: 23.3)RNA polymerase sigma factor, TIGR02999 family (TIGR02999; HMM-score: 21.2)Cellular processes Sporulation and germination RNA polymerase sigma-I factor (TIGR02895; HMM-score: 19.7)Transcription Transcription factors RNA polymerase sigma-I factor (TIGR02895; HMM-score: 19.7)RNA polymerase sigma-70 factor, Rhodopirellula/Verrucomicrobium family (TIGR02989; HMM-score: 18.8)RNA polymerase sigma-70 factor, Myxococcales family 1 (TIGR03001; HMM-score: 16.2)RNA polymerase sigma factor RpoE (TIGR02939; HMM-score: 13.7)
- TheSEED :
- RNA polymerase sigma factor SigB
Regulation and Cell signaling Quorum sensing and biofilm formation Biofilm formation in Staphylococcus RNA polymerase sigma factor SigBand 2 more - PFAM: HTH (CL0123) Sigma70_r3; Sigma-70 region 3 (PF04539; HMM-score: 67.2)Sigma70_r2; Sigma-70 region 2 (PF04542; HMM-score: 66.6)Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 64)and 17 moreSigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 25.1)Sigma70_ECF; ECF sigma factor (PF07638; HMM-score: 23.4)GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 21.5)HTH_Tnp_1; Transposase (PF01527; HMM-score: 18.9)HTH_16; Helix-turn-helix domain (PF12645; HMM-score: 18.5)HTH_23; Homeodomain-like domain (PF13384; HMM-score: 17.3)HTH_3; Helix-turn-helix (PF01381; HMM-score: 17)KORA; TrfB plasmid transcriptional repressor (PF16509; HMM-score: 16.7)HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 16.3)IF2_N; Translation initiation factor IF-2, N-terminal region (PF04760; HMM-score: 15.4)HTH_38; Helix-turn-helix domain (PF13936; HMM-score: 14.8)HTH_AsnC-type; AsnC-type helix-turn-helix domain (PF13404; HMM-score: 14.5)no clan defined DUF6761; Family of unknown function (DUF6761) (PF20547; HMM-score: 13.3)HTH (CL0123) HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 12.9)NirdL-like_HTH; Siroheme decarboxylase NirDL-like HTH domain (PF22451; HMM-score: 12.6)PhyR_sigma-like; Response regulator PhyR, sigma-like domain (PF22233; HMM-score: 12.1)LysM (CL0187) LysM3_LYK4_5; LYK4/5 LysM3 domain (PF23473; HMM-score: 11.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
- genes regulated by SigB*, sigma factor controlling a large regulon involved in stress/starvation response and adaptation [1] [2]
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9917
- Cytoplasmic Membrane Score: 0.0077
- Cell wall & surface Score: 0
- Extracellular Score: 0.0006
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.007397
- TAT(Tat/SPI): 0.000536
- LIPO(Sec/SPII): 0.000631
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MAKESKSANEISPEQINQWIKEHQENKNTDAQDKLVKHYQKLIESLAYKYSKGQSHHEDLVQVGMVGLIGAINRFDMSFERKFEAFLVPTVIGEIKRYLRDKTWSVHVPRRIKEIGPRIKKVSDELTAELERSPSISEIADRLEVSEEEVLEAMEMGQSYNALSVDHSIEADKDGSTVTLLDIMGQQDDHYDLTEKRMILEKILPILSDREREIIQCTFIEGLSQKETGERIGLSQMHVSRLQRTAIKKLQEAAHQ
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas [3] [4]
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SAOUHSC_00519 (rplA) 50S ribosomal protein L1 [5] (data from MRSA252) SAOUHSC_01211 (rplS) 50S ribosomal protein L19 [5] (data from MRSA252) SAOUHSC_01757 (rplU) 50S ribosomal protein L21 [5] (data from MRSA252) SAOUHSC_00524 (rpoB) DNA-directed RNA polymerase subunit beta [5] (data from MRSA252) SAOUHSC_00315 hypothetical protein [5] (data from MRSA252) SAOUHSC_00525 DNA-directed RNA polymerase subunit beta' [5] (data from MRSA252) SAOUHSC_01036 hypothetical protein [5] (data from MRSA252) SAOUHSC_01040 pyruvate dehydrogenase complex, E1 component subunit alpha [5] (data from MRSA252) SAOUHSC_01041 pyruvate dehydrogenase complex, E1 component subunit beta [5] (data from MRSA252) SAOUHSC_01042 branched-chain alpha-keto acid dehydrogenase subunit E2 [5] (data from MRSA252) SAOUHSC_01043 dihydrolipoamide dehydrogenase [5] (data from MRSA252) SAOUHSC_01490 DNA-binding protein HU [5] (data from MRSA252) SAOUHSC_02299 serine-protein kinase RsbW [5] (data from MRSA252) SAOUHSC_02369 DNA-directed RNA polymerase subunit delta [5] (data from MRSA252) SAOUHSC_02485 DNA-directed RNA polymerase subunit alpha [5] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: SAOUHSC_02298 < SAOUHSC_02299 < SAOUHSC_02300 < SAOUHSC_02301predicted SigA promoter [2] : S888 < SAOUHSC_02296 < SAOUHSC_02297 < S889 < SAOUHSC_02298 < SAOUHSC_02299 < SAOUHSC_02300 < S890 < SAOUHSC_02301 < S891 < SAOUHSC_02303 < SAOUHSC_02304predicted SigA promoter [2] : SAOUHSC_02298 < SAOUHSC_02299 < SAOUHSC_02300 < S890 < SAOUHSC_02301 < S891 < SAOUHSC_02303 < SAOUHSC_02304 < SAOUHSC_02305 < acpS < SAOUHSC_02307 < SAOUHSC_02308 < SAOUHSC_02309 < S892
⊟Regulation[edit | edit source]
- regulator: SigB* (activation) regulon
SigB* (sigma factor) controlling a large regulon involved in stress/starvation response and adaptation; [1] other strains
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [2]
Multi-gene expression profiles
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.0 1.1 Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
J Bacteriol: 2004, 186(13);4085-99
[PubMed:15205410] [WorldCat.org] [DOI] (P p) - ↑ 2.0 2.1 2.2 2.3 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e) - ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
Proteomics: 2015, 15(21);3648-61
[PubMed:26224020] [WorldCat.org] [DOI] (I p) - ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
Sci Rep: 2017, 7(1);9718
[PubMed:28887440] [WorldCat.org] [DOI] (I e) - ↑ 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)
⊟Relevant publications[edit | edit source]
Niles P Donegan, Ambrose L Cheung
Regulation of the mazEF toxin-antitoxin module in Staphylococcus aureus and its impact on sigB expression.
J Bacteriol: 2009, 191(8);2795-805
[PubMed:19181798] [WorldCat.org] [DOI] (I p)
