From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02877
  • pan locus tag?: SAUPAN006225000
  • symbol: SAOUHSC_02877
  • pan gene symbol?: crtN
  • synonym:
  • product: squalene synthase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_02877
  • symbol: SAOUHSC_02877
  • product: squalene synthase
  • replicon: chromosome
  • strand: -
  • coordinates: 2650767..2652275
  • length: 1509
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    ATGAAGATTGCAGTAATTGGTGCAGGTGTCACAGGATTAGCAGCGGCAGCCCGTATTGCT
    TCTCAAGGTCATGAAGTGACGATATTTGAAAAAAATAATAATGTAGGCGGGCGTATGAAT
    CAATTAAAGAAAGACGGCTTTACATTTGATATGGGTCCCACAATTGTCATGATGCCAGAT
    GTTTATAAAGATGTTTTTACAGCGTGTGGTAAAAATTATGAAGATTATATTGAATTGAGA
    CAATTACGTTATATTTACGATGTGTATTTTGACCACGATGATCGTATAACGGTGCCTACA
    GATTTAGCTGAATTACAGCAAATGCTAGAAAGTATAGAACCTGGTTCAACGCATGGTTTT
    ATGTCCTTTTTAACGGATGTTTATAAAAAATATGAAATTGCACGTCGCTATTTCTTAGAA
    AGAACGTATCGCAAACCGAGTGACTTTTATAATATGACGTCACTTGTGCAAGGTGCTAAG
    TTAAAAACGTTAAATCATGCAGATCAGCTAATTGAACATTATATTGATAACGAAAAGATA
    CAAAAGCTTTTAGCGTTTCAAACGTTATACATAGGAATTGATCCAAAACGAGGCCCGTCA
    CTATATTCAATTATTCCTATGATTGAAATGATGTTTGGTGTGCATTTTATTAAAGGCGGT
    ATGTATGGCATGGCTCAAGGGCTAGCGCAATTAAATAAAGACTTAGGCGTTAATATTGAA
    CTAAATGCTGAAATTGAGCAAATTATTATTGATCCTAAATTCAAACGGGCCGATGCGATA
    AAAGTGAATGGTGACATAAGAAAATTTGATAAAATTTTATGTACGGCTGATTTCCCTAGT
    GTTGCGGAATCATTAATGCCAGATTTTGCACCTATTAAAAAGTATCCACCACATAAAATT
    GCAGACTTAGATTACTCTTGTTCAGCATTTTTAATGTATATCGGTATAGATATTGATGTG
    ACAGATCAAGTGAGACTTCATAATGTTATTTTTTCAGATGACTTTAGAGGCAATATTGAA
    GAAATATTTGAGGGACGTTTATCATATGATCCTTCTATTTATGTGTATGTACCAGCGGTC
    GCTGATAAATCACTTGCGCCAGAAGGCAAAACTGGTATTTATGTGCTAATGCCGACGCCG
    GAACTTAAAACAGGTAGCGGAATCGATTGGTCAGATGAAGCTTTGACGCAACAAATAAAG
    GAAATTATTTATCGTAAATTAGCAACGATTGAAGTATTTGAAGATATAAAATCGCATATT
    GTTTCAGAAACAATCTTTACGCCAAATGATTTTGAGCAAACGTATCATGCGAAATTTGGT
    TCGGCATTCGGTTTAATGCCAACTTTAGCGCAAAGTAATTATTATCGTCCACAAAATGTA
    TCGCGAGATTATAAAGATTTATATTTTGCAGGTGCAAGTACGCATCCAGGTGCAGGCGTT
    CCTATTGTCTTAACGAGTGCGAAAATAACTGTAGATGAAATGATTAAAGATATTGAGCGG
    GGCGTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1509

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_02877
  • symbol: SAOUHSC_02877
  • description: squalene synthase
  • length: 502
  • theoretical pI: 5.15038
  • theoretical MW: 56741.7
  • GRAVY: -0.17012

Function[edit | edit source]

  • reaction:
    EC 1.3.8.2?  ExPASy
    4,4'-diapophytoene desaturase (4,4'-diapolycopene-forming) 15-cis-4,4'-diapophytoene + 4 FAD = all-trans-4,4'-diapolycopene + 4 FADH2
  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 437.7)
    and 39 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 79.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other carotene isomerase (TIGR02730; EC 5.-.-.-; HMM-score: 75)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin protoporphyrinogen oxidase (TIGR00562; EC 1.3.3.4; HMM-score: 47.5)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 43.9)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 32.7)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 31.6)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 30)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 27.9)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 26.5)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 26.5)
    Metabolism Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 26)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides UDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 25.8)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 25.2)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 24.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 23.5)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 21.8)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 21)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 18.8)
    Metabolism Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 18.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 17.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02731; EC 1.14.99.-; HMM-score: 17.6)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 17.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 16.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A 2-dehydropantoate 2-reductase (TIGR00745; EC 1.1.1.-; HMM-score: 15)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 14.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridine nucleotides L-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 13.4)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 13.4)
    Unknown function Enzymes of unknown specificity putative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 13.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 13)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA:m(5)U-54 methyltransferase (TIGR00137; EC 2.1.1.74; HMM-score: 12.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin precorrin 3B synthase CobZ (TIGR02485; HMM-score: 12.6)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 12.4)
    Metabolism Energy metabolism Pentose phosphate pathway 6-phosphogluconate dehydrogenase (decarboxylating) (TIGR00872; EC 1.1.1.44; HMM-score: 11.8)
    Cell structure Cell envelope Biosynthesis and degradation of murein sacculus and peptidoglycan UDP-N-acetylmuramoylalanine--D-glutamate ligase (TIGR01087; EC 6.3.2.9; HMM-score: 11.3)
    Cellular processes Cellular processes Detoxification CoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 11.3)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 11)
    3-hydroxyacyl-CoA dehydrogenase PaaC (TIGR02279; EC 1.1.1.-; HMM-score: 10.9)
    Metabolism Energy metabolism Electron transport NAD(P)(+) transhydrogenase (AB-specific), alpha subunit (TIGR00561; EC 1.6.1.2; HMM-score: 10.5)
    lycopene cyclase family protein (TIGR01790; HMM-score: 10.5)
  • TheSEED:  
    Fatty Acids, Lipids, and Isoprenoids Isoprenoids Polyprenyl Diphosphate Biosynthesis  Dehydrosqualene desaturase (EC 1.14.99.-) (Diapophytoene desaturase) (4,4'-diapophytoene desaturase)
  • PFAM:
    NADP_Rossmann (CL0063) Amino_oxidase; Flavin containing amine oxidoreductase (PF01593; HMM-score: 98.7)
    and 25 more
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 57.1)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 29)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 26.2)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 24.8)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 24)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 23.9)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 22)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 21.7)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 20.6)
    FMO-like; Flavin-binding monooxygenase-like (PF00743; HMM-score: 20.5)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 20.3)
    NAD_Gly3P_dh_N; NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus (PF01210; HMM-score: 19.1)
    Thi4; Thi4 family (PF01946; HMM-score: 17.9)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 17.7)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 17.5)
    NAD_binding_2; NAD binding domain of 6-phosphogluconate dehydrogenase (PF03446; HMM-score: 16.1)
    ApbA; Ketopantoate reductase PanE/ApbA (PF02558; HMM-score: 15.9)
    MCRA; MCRA family (PF06100; HMM-score: 15.7)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 14.8)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 13.9)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 13.4)
    no clan defined Bromodomain; Bromodomain (PF00439; HMM-score: 12.9)
    NADP_Rossmann (CL0063) IlvN; Acetohydroxy acid isomeroreductase, NADPH-binding domain (PF07991; HMM-score: 12.6)
    no clan defined KilA-N; KilA-N domain (PF04383; HMM-score: 12.4)
    NADP_Rossmann (CL0063) Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 12.4)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: N-terminally anchored (No CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.5
    • Signal peptide possibility: 0
    • N-terminally Anchored Score: 7
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: Signal peptide SP(Sec/SPI) length 23 aa
    • SP(Sec/SPI): 0.653165
    • TAT(Tat/SPI): 0.00485
    • LIPO(Sec/SPII): 0.101583
    • Cleavage Site: CS pos: 23-24. SQG-HE. Pr: 0.2989
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKIAVIGAGVTGLAAAARIASQGHEVTIFEKNNNVGGRMNQLKKDGFTFDMGPTIVMMPDVYKDVFTACGKNYEDYIELRQLRYIYDVYFDHDDRITVPTDLAELQQMLESIEPGSTHGFMSFLTDVYKKYEIARRYFLERTYRKPSDFYNMTSLVQGAKLKTLNHADQLIEHYIDNEKIQKLLAFQTLYIGIDPKRGPSLYSIIPMIEMMFGVHFIKGGMYGMAQGLAQLNKDLGVNIELNAEIEQIIIDPKFKRADAIKVNGDIRKFDKILCTADFPSVAESLMPDFAPIKKYPPHKIADLDYSCSAFLMYIGIDIDVTDQVRLHNVIFSDDFRGNIEEIFEGRLSYDPSIYVYVPAVADKSLAPEGKTGIYVLMPTPELKTGSGIDWSDEALTQQIKEIIYRKLATIEVFEDIKSHIVSETIFTPNDFEQTYHAKFGSAFGLMPTLAQSNYYRPQNVSRDYKDLYFAGASTHPGAGVPIVLTSAKITVDEMIKDIERGV

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: SigB* (activation) regulon
    SigB(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation [3] [4]   other strains

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J Bacteriol: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)
  4. 4.0 4.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]