From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02881
  • pan locus tag?: SAUPAN006228000
  • symbol: SAOUHSC_02881
  • pan gene symbol?: crtP
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_02881
  • symbol: SAOUHSC_02881
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2654320..2655813
  • length: 1494
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    ATGACTAAACATATCATCGTTATTGGTGGTGGCTTAGGTGGGATTTCTGCAGCAATTCGA
    ATGGCACAAAGTGGCTATTCGGTCTCATTATATGAACAAAATAATCATATAGGAGGCAAA
    GTGAATCGTCATGAATCAGATGGCTTTGGCTTTGATTTAGGTCCATCTATTTTAACGATG
    CCTTATATTTTTGAAAAATTATTCGAATATAGCAAGAAGCAAATGTCAGACTACGTTACA
    ATCAAGCGATTGCCACATCAATGGCGTAGCTTTTTTCCAGATGGAACGACTATCGATTTG
    TATGAAGGTATTAAAGAAACAGGTCAGCATAATGCGATATTGTCGAAACAGGATATAGAG
    GAACTGCAAAATTATTTGAATTATACAAGACGAATCGATCGTATTACTGAAAAAGGGTAT
    TTCAACTATGGTTTAGATACACTATCTCAAATTATTAAATTTCATGGGCCATTAAATGCT
    CTTATTAATTATGATTATGTACATACTATGCAACAGGCCATAGACAAGCGTATCTCGAAT
    CCATACTTGCGACAAATGTTAGGCTATTTTATCAAATATGTAGGTTCTTCATCATACGAT
    GCGCCAGCTGTATTATCTATGTTATTCCATATGCAACAAGAGCAAGGCCTTTGGTATGTA
    GAAGGTGGAATCCATCATTTAGCCAATGCCTTGGAAAAGCTAGCGCGTGAAGAAGGTGTC
    ACAATTCATACAGGTGCACGTGTGGACAATATTAAAACATATCAAAGACGTGTGACGGGT
    GTCAGATTAGATACAGGTGAGTTTGTAAAGGCAGATTATATTATTTCAAATATGGAAGTC
    ATACCTACTTATAAATATTTAATTCACCTTGATACTCAACGATTAAACAAATTAGAGAGG
    GAATTTGAGCCGGCAAGCTCAGGATATGTGATGCATTTAGGTGTTGCTTGCCAATACCCG
    CAATTAGCACATCATAATTTCTTTTTTACGGAAAATGCTTATCTCAATTATCAACAAGTT
    TTTCATGAAAAGGTATTGCCAGATGATCCGACCATTTATCTAGTAAATACGAATAAAACT
    GATCACACACAAGCGCCAGTAGGTTATGAAAATATCAAAGTCTTACCACATATTCCATAT
    ATTCAAGATCAGCCTTTTACCACTGAAGATTATGCGAAGTTTAGGGATAAAATTTTGGAT
    AAATTAGAAAAAATGGGACTTACTGATTTAAGAAAACACATTATTTATGAAGATGTTTGG
    ACACCGGAGGATATTGAAAAAAATTATCGTTCTAATCGTGGTGCAATATATGGTGTTGTA
    GCAGATAAAAAGAAAAACAAAGGATTTAAATTTCCTAAAGAAAGTCAGTATTTTGAAAAC
    TTGTACTTTGTAGGTGGATCAGTAAATCCTGGTGGTGGCATGCCAATGGTTACATTAAGT
    GGGCAACAAGTCGCAGACAAAATAAACGCGCGAGAAGCGAAGAATAGGAAGTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1494

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_02881
  • symbol: SAOUHSC_02881
  • description: hypothetical protein
  • length: 497
  • theoretical pI: 7.93809
  • theoretical MW: 57186.6
  • GRAVY: -0.491549

Function[edit | edit source]

  • reaction:
    EC 1.14.99.44?  ExPASy
    Diapolycopene oxygenase 4,4'-diapolycopene + 4 AH2 + 4 O2 = 4,4'-diapolycopenedial + 4 A + 6 H2O
  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 330.4)
    and 43 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other carotene isomerase (TIGR02730; EC 5.-.-.-; HMM-score: 96.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 87.6)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 39.9)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 36.7)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 34.7)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 33.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin protoporphyrinogen oxidase (TIGR00562; EC 1.3.3.4; HMM-score: 30.9)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 30.1)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 28.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 25.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin precorrin 3B synthase CobZ (TIGR02485; HMM-score: 22.3)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA:m(5)U-54 methyltransferase (TIGR00137; EC 2.1.1.74; HMM-score: 22.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 20.7)
    Metabolism Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 19)
    Cellular processes Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 18.3)
    Cellular processes Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 18.3)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 17.2)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 16.1)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 15.7)
    Cellular processes Cellular processes Detoxification mercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 15.7)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 15.5)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides UDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 15)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 14.8)
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01811; EC 1.3.99.1; HMM-score: 14.7)
    Metabolism Energy metabolism Electron transport thioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 14.1)
    Metabolism Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 14)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 13.9)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 13.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 13.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02731; EC 1.14.99.-; HMM-score: 13.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 13.1)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, monomeric form (TIGR01377; HMM-score: 12.8)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 12.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 12.2)
    Unknown function Enzymes of unknown specificity GMC family mycofactocin-associated oxidreductase (TIGR04542; EC 1.-.-.-; HMM-score: 12.1)
    lycopene cyclase family protein (TIGR01790; HMM-score: 11.7)
    Unknown function Enzymes of unknown specificity putative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 11.5)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 11)
    Metabolism Amino acid biosynthesis Other pyrrolysine biosynthesis protein PylD (TIGR03911; HMM-score: 10.9)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 10.8)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 10.3)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 10.1)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, A subunit (TIGR03377; EC 1.1.5.3; HMM-score: 9.1)
  • TheSEED:  
    Fatty Acids, Lipids, and Isoprenoids Isoprenoids Carotenoid biosynthesis  4,4'-diapolycopene oxidase
    and 3 more
    Phytoene desaturase, neurosporene or lycopene producing (EC 1.3.-.-)
    Carotenoids  4,4'-diapolycopene oxidase
    Phytoene desaturase, neurosporene or lycopene producing (EC 1.3.-.-)
  • PFAM:
    NADP_Rossmann (CL0063) Amino_oxidase; Flavin containing amine oxidoreductase (PF01593; HMM-score: 91.3)
    and 15 more
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 53.7)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 43.8)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 42.8)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 36.5)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 36.2)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 35.1)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 34.2)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 30.5)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 17.3)
    Trp_halogenase; Tryptophan halogenase (PF04820; HMM-score: 13.8)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 13.4)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 12.6)
    Thi4; Thi4 family (PF01946; HMM-score: 12.3)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 12.1)
    MCRA; MCRA family (PF06100; HMM-score: 11.8)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 0.67
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.199482
    • TAT(Tat/SPI): 0.015876
    • LIPO(Sec/SPII): 0.05323
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTKHIIVIGGGLGGISAAIRMAQSGYSVSLYEQNNHIGGKVNRHESDGFGFDLGPSILTMPYIFEKLFEYSKKQMSDYVTIKRLPHQWRSFFPDGTTIDLYEGIKETGQHNAILSKQDIEELQNYLNYTRRIDRITEKGYFNYGLDTLSQIIKFHGPLNALINYDYVHTMQQAIDKRISNPYLRQMLGYFIKYVGSSSYDAPAVLSMLFHMQQEQGLWYVEGGIHHLANALEKLAREEGVTIHTGARVDNIKTYQRRVTGVRLDTGEFVKADYIISNMEVIPTYKYLIHLDTQRLNKLEREFEPASSGYVMHLGVACQYPQLAHHNFFFTENAYLNYQQVFHEKVLPDDPTIYLVNTNKTDHTQAPVGYENIKVLPHIPYIQDQPFTTEDYAKFRDKILDKLEKMGLTDLRKHIIYEDVWTPEDIEKNYRSNRGAIYGVVADKKKNKGFKFPKESQYFENLYFVGGSVNPGGGMPMVTLSGQQVADKINAREAKNRK

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: SigB* (activation) regulon
    SigB(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation [3] [4]   other strains

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J Bacteriol: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)
  4. 4.0 4.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]

Luan Tao, Andreas Schenzle, J Martin Odom, Qiong Cheng
Novel carotenoid oxidase involved in biosynthesis of 4,4'-diapolycopene dialdehyde.
Appl Environ Microbiol: 2005, 71(6);3294-301
[PubMed:15933032] [WorldCat.org] [DOI] (P p)