Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_2022 [new locus tag: SAUSA300_RS11120 ]
- pan locus tag?: SAUPAN005333000
- symbol: rpoF
- pan gene symbol?: sigB
- synonym:
- product: RNA polymerase sigma factor SigB
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_2022 [new locus tag: SAUSA300_RS11120 ]
- symbol: rpoF
- product: RNA polymerase sigma factor SigB
- replicon: chromosome
- strand: -
- coordinates: 2184996..2185766
- length: 771
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3914516 NCBI
- RefSeq: YP_494668 NCBI
- BioCyc: see SAUSA300_RS11120
- MicrobesOnline: 1293537 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721ATGGCGAAAGAGTCGAAATCAGCTAATGAAATTTCACCTGAGCAAATTAACCAATGGATT
AAAGAACACCAAGAAAATAAGAATACAGATGCACAGGATAAGTTAGTTAAACATTACCAA
AAACTAATTGAGTCATTGGCATATAAATATTCTAAAGGACAATCACATCACGAAGATTTA
GTTCAAGTTGGTATGGTTGGTTTAATAGGTGCCATAAATAGATTCGATATGTCCTTTGAA
CGGAAGTTTGAAGCCTTTTTAGTACCTACTGTAATCGGTGAAATCAAAAGATATCTACGA
GATAAAACTTGGAGTGTACATGTTCCGAGACGTATTAAAGAAATTGGGCCAAGAATCAAA
AAAGTGAGCGATGAACTAACCGCTGAATTAGAGCGTTCACCTTCTATCAGTGAAATAGCT
GATCGATTAGAAGTCTCAGAAGAAGAAGTGTTAGAAGCAATGGAAATGGGACAAAGTTAT
AATGCGTTAAGTGTTGATCATTCCATTGAAGCTGATAAAGATGGTTCAACTGTTACGCTA
TTAGATATTATGGGGCAACAAGATGACCATTATGACTTAACTGAAAAACGTATGATTTTA
GAAAAAATATTACCTATATTATCTGATCGCGAACGAGAAATCATACAATGTACGTTTATT
GAAGGATTGAGTCAAAAAGAGACAGGTGAGCGTATCGGTTTAAGTCAAATGCATGTATCA
CGACTTCAGAGAACGGCAATTAAGAAATTACAAGAAGCAGCACATCAATAG60
120
180
240
300
360
420
480
540
600
660
720
771
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_2022 [new locus tag: SAUSA300_RS11120 ]
- symbol: RpoF
- description: RNA polymerase sigma factor SigB
- length: 256
- theoretical pI: 5.645
- theoretical MW: 29443.3
- GRAVY: -0.616016
⊟Function[edit | edit source]
- TIGRFAM: RNA polymerase sigma-B factor (TIGR02941; HMM-score: 485.3)and 30 moreRNA polymerase sigma-70 factor, sigma-B/F/G subfamily (TIGR02980; HMM-score: 303.8)Cellular processes Sporulation and germination RNA polymerase sigma-F factor (TIGR02885; HMM-score: 179.8)Transcription Transcription factors RNA polymerase sigma-F factor (TIGR02885; HMM-score: 179.8)Cellular processes Sporulation and germination RNA polymerase sigma-G factor (TIGR02850; HMM-score: 145.1)Transcription Transcription factors RNA polymerase sigma-G factor (TIGR02850; HMM-score: 145.1)RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 138.1)RNA polymerase sigma factor, FliA/WhiG family (TIGR02479; HMM-score: 119.6)RNA polymerase sigma factor, cyanobacterial RpoD-like family (TIGR02997; HMM-score: 92.6)Transcription Transcription factors RNA polymerase sigma factor RpoD (TIGR02393; HMM-score: 81.4)Cellular processes Sporulation and germination RNA polymerase sigma-K factor (TIGR02846; HMM-score: 69.9)Transcription Transcription factors RNA polymerase sigma-K factor (TIGR02846; HMM-score: 69.9)Cellular processes Adaptations to atypical conditions alternative sigma factor RpoH (TIGR02392; HMM-score: 67.8)Transcription Transcription factors alternative sigma factor RpoH (TIGR02392; HMM-score: 67.8)Cellular processes Adaptations to atypical conditions RNA polymerase sigma factor RpoS (TIGR02394; HMM-score: 65.4)Transcription Transcription factors RNA polymerase sigma factor RpoS (TIGR02394; HMM-score: 65.4)Cellular processes Sporulation and germination RNA polymerase sigma-E factor (TIGR02835; HMM-score: 63)Transcription Transcription factors RNA polymerase sigma-E factor (TIGR02835; HMM-score: 63)RNA polymerase sigma-70 factor, Bacteroides expansion family 1 (TIGR02985; HMM-score: 47)RNA polymerase sigma-70 factor, Planctomycetaceae-specific subfamily 1 (TIGR02984; HMM-score: 35.8)Cellular processes Sporulation and germination RNA polymerase sigma-H factor (TIGR02859; HMM-score: 35.1)Transcription Transcription factors RNA polymerase sigma-H factor (TIGR02859; HMM-score: 35.1)RNA polymerase sigma-70 factor, TIGR02952 family (TIGR02952; HMM-score: 34)RNA polymerase sigma factor, SigZ family (TIGR02959; HMM-score: 26.3)RNA polymerase sigma-70 factor, sigma-E family (TIGR02983; HMM-score: 23.3)RNA polymerase sigma factor, TIGR02999 family (TIGR02999; HMM-score: 21.2)Cellular processes Sporulation and germination RNA polymerase sigma-I factor (TIGR02895; HMM-score: 19.7)Transcription Transcription factors RNA polymerase sigma-I factor (TIGR02895; HMM-score: 19.7)RNA polymerase sigma-70 factor, Rhodopirellula/Verrucomicrobium family (TIGR02989; HMM-score: 18.8)RNA polymerase sigma-70 factor, Myxococcales family 1 (TIGR03001; HMM-score: 16.2)RNA polymerase sigma factor RpoE (TIGR02939; HMM-score: 13.7)
- TheSEED :
- RNA polymerase sigma factor SigB
Regulation and Cell signaling Quorum sensing and biofilm formation Biofilm formation in Staphylococcus RNA polymerase sigma factor SigBand 2 more - PFAM: HTH (CL0123) Sigma70_r3; Sigma-70 region 3 (PF04539; HMM-score: 67.2)Sigma70_r2; Sigma-70 region 2 (PF04542; HMM-score: 66.6)Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 64)and 17 moreSigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 25.1)Sigma70_ECF; ECF sigma factor (PF07638; HMM-score: 23.4)GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 21.5)HTH_Tnp_1; Transposase (PF01527; HMM-score: 18.9)HTH_16; Helix-turn-helix domain (PF12645; HMM-score: 18.5)HTH_23; Homeodomain-like domain (PF13384; HMM-score: 17.3)HTH_3; Helix-turn-helix (PF01381; HMM-score: 17)KORA; TrfB plasmid transcriptional repressor (PF16509; HMM-score: 16.7)HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 16.3)IF2_N; Translation initiation factor IF-2, N-terminal region (PF04760; HMM-score: 15.4)HTH_38; Helix-turn-helix domain (PF13936; HMM-score: 14.8)HTH_AsnC-type; AsnC-type helix-turn-helix domain (PF13404; HMM-score: 14.5)no clan defined DUF6761; Family of unknown function (DUF6761) (PF20547; HMM-score: 13.3)HTH (CL0123) HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 12.9)NirdL-like_HTH; Siroheme decarboxylase NirDL-like HTH domain (PF22451; HMM-score: 12.6)PhyR_sigma-like; Response regulator PhyR, sigma-like domain (PF22233; HMM-score: 12.1)LysM (CL0187) LysM3_LYK4_5; LYK4/5 LysM3 domain (PF23473; HMM-score: 11.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
- genes regulated by SigB*, sigma factor controlling a large regulon involved in stress/starvation response and adaptation: in COL, JSNZ, NCTC8325, Newman
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9917
- Cytoplasmic Membrane Score: 0.0077
- Cell wall & surface Score: 0
- Extracellular Score: 0.0006
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.007397
- TAT(Tat/SPI): 0.000536
- LIPO(Sec/SPII): 0.000631
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MAKESKSANEISPEQINQWIKEHQENKNTDAQDKLVKHYQKLIESLAYKYSKGQSHHEDLVQVGMVGLIGAINRFDMSFERKFEAFLVPTVIGEIKRYLRDKTWSVHVPRRIKEIGPRIKKVSDELTAELERSPSISEIADRLEVSEEEVLEAMEMGQSYNALSVDHSIEADKDGSTVTLLDIMGQQDDHYDLTEKRMILEKILPILSDREREIIQCTFIEGLSQKETGERIGLSQMHVSRLQRTAIKKLQEAAHQ
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SAUSA300_1362 (hup) DNA-binding protein HU [1] (data from MRSA252) SAUSA300_0996 (lpdA) dihydrolipoamide dehydrogenase [1] (data from MRSA252) SAUSA300_0993 (pdhA) pyruvate dehydrogenase E1 component, alpha subunit [1] (data from MRSA252) SAUSA300_0994 (pdhB) pyruvate dehydrogenase E1 component, beta subunit [1] (data from MRSA252) SAUSA300_0523 (rplA) 50S ribosomal protein L1 [1] (data from MRSA252) SAUSA300_1134 (rplS) 50S ribosomal protein L19 [1] (data from MRSA252) SAUSA300_1603 (rplU) 50S ribosomal protein L21 [1] (data from MRSA252) SAUSA300_2178 (rpoA) DNA-directed RNA polymerase subunit alpha [1] (data from MRSA252) SAUSA300_0527 (rpoB) DNA-directed RNA polymerase subunit beta [1] (data from MRSA252) SAUSA300_0528 (rpoC) DNA-directed RNA polymerase subunit beta' [1] (data from MRSA252) SAUSA300_2082 (rpoE) DNA-directed RNA polymerase subunit delta [1] (data from MRSA252) SAUSA300_2023 (rsbW) serine-protein kinase RsbW [1] (data from MRSA252) SAUSA300_0335 MATE efflux family protein [1] (data from MRSA252) SAUSA300_0990 hypothetical protein [1] (data from MRSA252) SAUSA300_0995 branched-chain alpha-keto acid dehydrogenase subunit E2 [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: rpoF < rsbW < rsbV < rsbU
⊟Regulation[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)