Jump to navigation
Jump to search
NCBI: 01-DEC-2025
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_002025 [new locus tag: EGJ38_RS10110 ]
- pan locus tag?: SAUPAN005333000
- symbol: sigB
- pan gene symbol?: sigB
- synonym:
- alternate name: JSNZ_002025
- product: RNA polymerase sigma factor SigB
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_002025 [new locus tag: EGJ38_RS10110 ]
- symbol: sigB
- product: RNA polymerase sigma factor SigB
- replicon: chromosome
- strand: -
- coordinates: 2041497..2042267
- length: 771
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq: MGT2423926 NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721ATGGCGAAAGAGTCGAAATCAGCTAATGAAGTTTCACCTGAGCAAATTAACCAATGGATT
AAAGAACACCAAGAAAATAAGAATACAGATGCACAGGATAAGTTAGTTAAACATTACCAA
AAACTAATTGAGTCATTGGCATATAAATATTCTAAAGGACAATCACATCACGAAGATTTA
GTTCAAGTTGGTATGGTTGGTTTAATAGGTGCCATAAATAGATTCGATATGTCCTTTGAA
CGGAAGTTTGAAGCCTTTTTAGTACCTACTGTAATCGGTGAAATCAAAAGATATCTACGA
GATAAAACTTGGAGTGTACATGTTCCGAGACGTATTAAAGAAATTGGGCCAAGAATCAAA
AAAGTGAGCGATGAACTAACCGCTGAATTAGAGCGTTCACCTTCTATCAGTGAAATAGCT
GATCGATTAGAAGTTTCAGAAGAAGAAGTGTTAGAAGCAATGGAAATGGGACAAAGTTAT
AATGCGTTAAGTGTTGATCATTCCATTGAAGCTGATAAAGATGGTTCAACTGTTACGCTA
TTAGATATTATGGGACAACAAGATGACCATTATGACTTAACTGAAAAACGTATGATTTTA
GAAAAAATATTACCTATATTATCTGATCGCGAACGAGAAATCATACAATGTACGTTTATT
GAAGGTTTGAGTCAAAAAGAGACAGGTGAGCGTATCGGTTTAAGTCAAATGCATGTATCA
CGACTTCAAAGAACGGCAATTAAGAAATTACAAGAAGCAGCACATAAATAG60
120
180
240
300
360
420
480
540
600
660
720
771
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_002025 [new locus tag: EGJ38_RS10110 ]
- symbol: SigB
- description: RNA polymerase sigma factor SigB
- length: 256
- theoretical pI: 5.85963
- theoretical MW: 29429.3
- GRAVY: -0.61875
⊟Function[edit | edit source]
- TIGRFAM: RNA polymerase sigma-B factor (TIGR02941; HMM-score: 486.3)and 30 moreRNA polymerase sigma-70 factor, sigma-B/F/G subfamily (TIGR02980; HMM-score: 303.8)Cellular processes Sporulation and germination RNA polymerase sigma-F factor (TIGR02885; HMM-score: 179.8)Transcription Transcription factors RNA polymerase sigma-F factor (TIGR02885; HMM-score: 179.8)Cellular processes Sporulation and germination RNA polymerase sigma-G factor (TIGR02850; HMM-score: 145.1)Transcription Transcription factors RNA polymerase sigma-G factor (TIGR02850; HMM-score: 145.1)RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 138.1)RNA polymerase sigma factor, FliA/WhiG family (TIGR02479; HMM-score: 119.7)RNA polymerase sigma factor, cyanobacterial RpoD-like family (TIGR02997; HMM-score: 92.6)Transcription Transcription factors RNA polymerase sigma factor RpoD (TIGR02393; HMM-score: 81.4)Cellular processes Sporulation and germination RNA polymerase sigma-K factor (TIGR02846; HMM-score: 69.9)Transcription Transcription factors RNA polymerase sigma-K factor (TIGR02846; HMM-score: 69.9)Cellular processes Adaptations to atypical conditions alternative sigma factor RpoH (TIGR02392; HMM-score: 67.5)Transcription Transcription factors alternative sigma factor RpoH (TIGR02392; HMM-score: 67.5)Cellular processes Adaptations to atypical conditions RNA polymerase sigma factor RpoS (TIGR02394; HMM-score: 65.5)Transcription Transcription factors RNA polymerase sigma factor RpoS (TIGR02394; HMM-score: 65.5)Cellular processes Sporulation and germination RNA polymerase sigma-E factor (TIGR02835; HMM-score: 63.1)Transcription Transcription factors RNA polymerase sigma-E factor (TIGR02835; HMM-score: 63.1)RNA polymerase sigma-70 factor, Bacteroides expansion family 1 (TIGR02985; HMM-score: 46.9)RNA polymerase sigma-70 factor, Planctomycetaceae-specific subfamily 1 (TIGR02984; HMM-score: 35.8)Cellular processes Sporulation and germination RNA polymerase sigma-H factor (TIGR02859; HMM-score: 35)Transcription Transcription factors RNA polymerase sigma-H factor (TIGR02859; HMM-score: 35)RNA polymerase sigma-70 factor, TIGR02952 family (TIGR02952; HMM-score: 34)RNA polymerase sigma factor, SigZ family (TIGR02959; HMM-score: 26)RNA polymerase sigma-70 factor, sigma-E family (TIGR02983; HMM-score: 23.2)RNA polymerase sigma factor, TIGR02999 family (TIGR02999; HMM-score: 21.2)Cellular processes Sporulation and germination RNA polymerase sigma-I factor (TIGR02895; HMM-score: 19.7)Transcription Transcription factors RNA polymerase sigma-I factor (TIGR02895; HMM-score: 19.7)RNA polymerase sigma-70 factor, Rhodopirellula/Verrucomicrobium family (TIGR02989; HMM-score: 18.8)RNA polymerase sigma-70 factor, Myxococcales family 1 (TIGR03001; HMM-score: 16.2)RNA polymerase sigma factor RpoE (TIGR02939; HMM-score: 13.7)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: HTH (CL0123) Sigma70_r3; Sigma-70 region 3 (PF04539; HMM-score: 67)Sigma70_r2; Sigma-70 region 2 (PF04542; HMM-score: 66.6)Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 64)and 16 moreSigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 25)Sigma70_ECF; ECF sigma factor (PF07638; HMM-score: 23.4)GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 21.5)HTH_Tnp_1; Transposase (PF01527; HMM-score: 19.3)HTH_16; Helix-turn-helix domain (PF12645; HMM-score: 18.5)HTH_23; Homeodomain-like domain (PF13384; HMM-score: 17.3)HTH_3; Helix-turn-helix (PF01381; HMM-score: 17.2)KORA; TrfB plasmid transcriptional repressor (PF16509; HMM-score: 16.8)IF2_N; Translation initiation factor IF-2, N-terminal region (PF04760; HMM-score: 15.3)HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 15.3)HTH_38; Helix-turn-helix domain (PF13936; HMM-score: 14.7)HTH_AsnC-type; AsnC-type helix-turn-helix domain (PF13404; HMM-score: 14.5)no clan defined DUF6761; Family of unknown function (DUF6761) (PF20547; HMM-score: 13.3)HTH (CL0123) HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 12.9)NirdL-like_HTH; Siroheme decarboxylase NirDL-like HTH domain (PF22451; HMM-score: 12.6)PhyR_sigma-like; Response regulator PhyR, sigma-like domain (PF22233; HMM-score: 12.3)
⊟Structure, modifications & cofactors[edit | edit source]
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9906
- Cytoplasmic Membrane Score: 0.0085
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.0008
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.007805
- TAT(Tat/SPI): 0.00056
- LIPO(Sec/SPII): 0.000709
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: MGT2423926 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MAKESKSANEVSPEQINQWIKEHQENKNTDAQDKLVKHYQKLIESLAYKYSKGQSHHEDLVQVGMVGLIGAINRFDMSFERKFEAFLVPTVIGEIKRYLRDKTWSVHVPRRIKEIGPRIKKVSDELTAELERSPSISEIADRLEVSEEEVLEAMEMGQSYNALSVDHSIEADKDGSTVTLLDIMGQQDDHYDLTEKRMILEKILPILSDREREIIQCTFIEGLSQKETGERIGLSQMHVSRLQRTAIKKLQEAAHK
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: SigB (activation) regulon
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.0 1.1 Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
J Bacteriol: 2004, 186(13);4085-99
[PubMed:15205410] [WorldCat.org] [DOI] (P p) - ↑ 2.0 2.1 Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
The sigmaB regulon in Staphylococcus aureus and its regulation.
Int J Med Microbiol: 2006, 296(4-5);237-58
[PubMed:16644280] [WorldCat.org] [DOI] (P p) - ↑ 3.0 3.1 Bettina Schulthess, Dominik A Bloes, Patrice François, Myriam Girard, Jacques Schrenzel, Markus Bischoff, Brigitte Berger-Bächi
The σB-dependent yabJ-spoVG operon is involved in the regulation of extracellular nuclease, lipase, and protease expression in Staphylococcus aureus.
J Bacteriol: 2011, 193(18);4954-62
[PubMed:21725011] [WorldCat.org] [DOI] (I p) - ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
Bioinformatics: 2018, 34(23);4118-4120
[PubMed:29931111] [WorldCat.org] [DOI] (I p)